We narrowed to 6,163 results for: cas9 expression plasmid
-
Plasmid#204291PurposeFor inserting a phiC31 attP site. HDR integrant is marked with ie1-DsRed, which is expressed in abdomen and mouthparts. Second U6 promoter allows use of two different gRNAs in two synthesized arms.DepositorInsertie1-DsRed
UseCRISPRPromoterie1Available SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJAT7
Plasmid#204292PurposeFor inserting a phiC31 attP site. HDR integrant is marked with removable 3XP3-DsRed cassette, which is expressed in eyes. DsRed difficult to see in wild type eyes if using LeicaM165 FC microscope.DepositorInsert3XP3-DsRed
UseCRISPRPromoter3XP3Available SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRGEB34
Plasmid#158152PurposeConstruction of inPTG-Cas9 plasmids with a truncated 5'-UTR intron for plant genome editingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpRY-P2A-mScarlet (MNW002)
Plasmid#174137PurposeCMV and T7 promoter expression plasmid for human codon optimized SpRY(A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1322R/R1333P/R1335Q/T1337R); C-terminal bi-partite NLS, 3x flag tag, P2A-mScarletDepositorInserthuman codon optimized SpRY with BPNLS-3xFLAG-P2A-mScarlet
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-mScarletExpressionMammalianMutationSpG=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317…PromoterCMV and T7Available SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-FeGFP
Plasmid#138261PurposeDonor-eGFP vector to be used in plasmid to plasmid integration reporter assay. eGFP is conditionally expressed when integrated at iCas9-sites on acceptor plasmidDepositorInserteGFP
UseCRISPRExpressionMammalianPromoterNoneAvailable SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v1)-PGK-Puro-BFP
Plasmid#117140PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v1 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-multi-Guide
Plasmid#85401PurposeLentiviral vector for the delivery of multiple sgRNAs targeting different genes in combination with inducible Cas9 expresssion by pLenti-iCas9-neoDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBLO1808_arC9_2xNLS_human
Plasmid#74491PurposeHuman codon optimized plasmid to express arC9 t2a mCherry w/2xNLS and a sgRNADepositorInsertarC9
Tagst2a mCherryExpressionMammalianAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSc1-DD
Plasmid#80439PurposeExpresses eGFP with ecDHFR along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRTagsE. coli dihydrofolate reductaseExpressionMammalianPromoterCMV and U6Available SinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSc1-puro
Plasmid#80438PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cell, and also confers resistance to puromycinDepositorInsertssp Cas9 gRNA
eGFP
Puromycin resistance
UseCRISPRExpressionMammalianPromoterCMV, U6, and hPGKAvailable SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2T-gRNA2
Plasmid#196253PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA for guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV GG hUbC-dsRED
Plasmid#84034PurposeContains Golden Gate cassette to express up to four gRNAs and dsREDDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
AP582-2
Plasmid#70049PurposeExpresses Ollas::mCherry::linker::H2B::V5 in bacteriaDepositorInsertmCherry::linker::H2B
TagsOllas and V5ExpressionBacterialAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2443
Plasmid#72252PurposeHuman expression plasmid for SpCas9-VRQR-HF1 variant: CMV-T7-humanSpCas9-VRQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335Q, T1337R)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 VRQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/G1218R/R1335Q/T1337R)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335…PromoterCMVAvailable SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only