We narrowed to 11,308 results for: ena
-
Plasmid#193863PurposeE. coli expression vector for N-ter GFP11 and C-ter R9 tagged lifeact peptide.DepositorInsertLifeact
Tags6xHis, GFP11, and R9ExpressionBacterialPromoterT7 PromoterAvailable SinceAug. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-PlmCasX(T26R/K610R/K808R)-T2A-EGFP
Plasmid#188274PurposeMammalian expression, Genome editingDepositorInsertPlmCasX(T26R/K610R/K808R)
UseCRISPRExpressionMammalianMutationnonePromoterCAGAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tornado-RNA sensor for survivin
Plasmid#185405Purposecircular RNA-scaffolded sensing modules for survivinDepositorInsertcircular RNA-scaffolded sensing modules
ExpressionMammalianMutationWTPromoterU6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPW3757 : CMVd3-ERmembrane-2xHaloTag-KKMP
Plasmid#185679PurposeLow-level transient expression of two tandem HaloTag proteins targeted to the ER membrane.DepositorInsertERmembrane-2xHaloTag-KKMP
ExpressionMammalianAvailable SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSilencer2.1-U6-T1-U6-bc339
Plasmid#190849PurposeFor mammalian expression of T1 and bc339, the RNA aptamers of ncOGT and β-catenin, respectively. Expression of each aptamer is driven by a U6 promoter.DepositorInsertsT1 (an RNA aptamer of O-GlcNAc Transferase)
bc339 (an RNA aptamer of β-catenin)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLY227
Plasmid#184148Purposeshort crRNA generator with spacer LEA2 with WT repeat regionDepositorInserts-crRNA-LEA2-WT
UseSynthetic BiologyPromoterPlux2Available SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY232
Plasmid#184149Purposeshort tracrRNA generator with WT anti-repeat regionDepositorInserts-tracrRNA-WT
UseSynthetic BiologyExpressionBacterialPromoteraraBAD promoterAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY171
Plasmid#184145PurposesgRNA with 3 RNA aptemers BoxB at the 3'-end for CRISPRaDepositorInsertsgRNA-LEA2-ex3
UseSynthetic BiologyPromoterPlux2Available SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131-RZ-Cas12j2
Plasmid#189782PurposeGolden Gate entry vector to clone the 1st Cas12j2(CasΦ) crRNA flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132-RZ-Cas12j2
Plasmid#189783PurposeGolden Gate entry vector to clone the 2nd Cas12j2(CasΦ) crRNA flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134-RZ-Cas12j2
Plasmid#189785PurposeGolden Gate entry vector to clone the 4th Cas12j2(CasΦ) crRNA flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131-RZ-Cas12j2
Plasmid#173927PurposeGolden Gate entry vector; empty vector to clone the 1st Cas12j2 crRNA with ribozyme processingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132-RZ-Cas12j2
Plasmid#173928PurposeGolden Gate entry vector; empty vector to clone the 2nd Cas12j2 crRNA with ribozyme processingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133-RZ-Cas12j2
Plasmid#173929PurposeGolden Gate entry vector; empty vector to clone the 3rd Cas12j2 crRNA with ribozyme processingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134-RZ-Cas12j2
Plasmid#173930PurposeGolden Gate entry vector; empty vector to clone the 4th Cas12j2 crRNA with ribozyme processingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251::PpsbA2*::B0032::CYP110D1
Plasmid#186707PurposeCYP110D1 coding sequence under the control of PpsbA2* promoter and the BBa_B0032 RBS, for the expression in Synechocystis.DepositorInsertalr4766
UseSynthetic BiologyPromoterPpsbA2*Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251::Ptrc.x.tetO2::B0032::CYP110D1
Plasmid#186709PurposeCYP110D1 coding sequence under the control of Ptrc.x.tetO2 promoter and the BBa_B0032 RBS, for the expression in Synechocystis.DepositorInsertalr4766
UseSynthetic BiologyPromoterPtrc.x.tetO2Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOD_004
Plasmid#155361PurposeGentamycin version of the scarless genome engineering pDEL plasmid (Tikh et al. 2016) compatible with SalmonellaDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOD_003
Plasmid#155362PurposeZeomycin version of the scarless genome engineering pDEL plasmid (Tikh et al. 2016) compatible with SalmonellaDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBA1031
Plasmid#189584PurposeEdH4gp0214 deletion HR vector 250bp HR Arms (EdH4 phage editing)DepositorInsertEdH4gp0214 Deletion Locus 250bp Homology Arms
UseSynthetic BiologyExpressionBacterialMutationEncodes for a full deletion of EdH4gp0214Available SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBA1030
Plasmid#189582PurposeEdH4gp0004 deletion HR vector 250bp HR Arms (EdH4 phage editing)DepositorInsertEdH4gp0004 Deletion Locus 250bp Homology Arms
UseSynthetic BiologyExpressionBacterialMutationEncodes for a full deletion of EdH4gp0004Available SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MTOR
Plasmid#183311PurposeAll-in-One CRISPRko system with a guide RNA that targets MTOR geneDepositorInsertMTOR
UseLentiviralAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_BRAF
Plasmid#183273PurposeAll-in-One CRISPRko system with a guide RNA that targets BRAF geneDepositorInsertBRAF
UseLentiviralAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEUK028
Plasmid#180826PurposeT7-inducible expression construct to produce SwGdmA (SWIT_RS16490) in E. coliDepositorArticleInsertSwGdmA (SWIT_RS16490 Synthetic, Sphingomonas wittichii RW1)
Tags6X HisExpressionBacterialPromoterT7Available SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEUK037
Plasmid#180829PurposeT7-inducible expression construct to produce CnGdmB (CNE_RS35790) in E. coliDepositorArticleAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEUK066
Plasmid#180830PurposeT7-inducible expression construct to produce NaGdmA (SARO_RS07455) in E. coliDepositorArticleInsertNaGdmA
Tags6X HisExpressionBacterialPromoterT7Available SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_CYP19A1
Plasmid#183280PurposeAll-in-One CRISPRko system with a guide RNA that targets CYP19A1 geneDepositorInsertCYP19A1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_DHFR
Plasmid#183281PurposeAll-in-One CRISPRko system with a guide RNA that targets DHFR geneDepositorInsertDHFR
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FLT1
Plasmid#183292PurposeAll-in-One CRISPRko system with a guide RNA that targets FLT1 geneDepositorInsertFLT1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_YES1
Plasmid#183329PurposeAll-in-One CRISPRko system with a guide RNA that targets YES1 geneDepositorInsertYES1
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TYMS
Plasmid#183326PurposeAll-in-One CRISPRko system with a guide RNA that targets TYMS geneDepositorInsertTYMS
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ROS1
Plasmid#183320PurposeAll-in-One CRISPRko system with a guide RNA that targets ROS1 geneDepositorInsertROS1
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_SMO
Plasmid#183321PurposeAll-in-One CRISPRko system with a guide RNA that targets SMO geneDepositorInsertSMO
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_RET
Plasmid#183319PurposeAll-in-One CRISPRko system with a guide RNA that targets RET geneDepositorInsertRET
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_RARA
Plasmid#183318PurposeAll-in-One CRISPRko system with a guide RNA that targets RARA geneDepositorInsertRARA
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_PSMB5
Plasmid#183317PurposeAll-in-One CRISPRko system with a guide RNA that targets PSMB5 geneDepositorInsertPSMB5
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_PIK3CD
Plasmid#183316PurposeAll-in-One CRISPRko system with a guide RNA that targets PIK3CD geneDepositorInsertPIK3CD
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only