We narrowed to 9,094 results for: sgRNA
-
Plasmid#234771PurposeNon Targeting ControlDepositorInsertNon Targeting Control sgRNA
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
EC70205
Plasmid#209466PurposeCloning protospacers for Cas9 editingDepositorInsertCas9 sgRNA
UseCRISPRPromoterTaU6Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
EC70188
Plasmid#209449PurposeCloning protospacers for Cas9 editingDepositorInsertCas9 sgRNA
UseCRISPRPromoterHvU3Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
EC70203
Plasmid#209464PurposeCloning protospacers for Cas9 editingDepositorInsertCas9 sgRNA
UseCRISPRPromoterTaU6Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMP1333
Plasmid#119268Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1159
Plasmid#119250Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPEPX-P3-sgRNAluc
Plasmid#85590PurposeIntegrate plasmid of Streptococcus pneumoniae, which can integrate sgRNA targeting luc gene, which encode luciferase, into the locus between amiF and treR. This vector can be used as the template forDepositorInsertsgRNA targeting firefly luciferase encoding gene
UseCRISPRExpressionBacterialPromoterP3Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDYT001
Plasmid#186549PurposeLineage tracing vector (with barcoded Target Sites and triple sgRNAs)DepositorInsert14-bp random integration barcode and three target sites and 3x sgRNAs
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterEF1alphaAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCBS-4803
Plasmid#249321PurposeExpresses an sgRNA to target the KanR* site on the engineered E. coli MG1655 strain and contains the Repair Template to replace the KanR* on the genome of E. coli MG1655DepositorInsertsgRNA targeting the KanR* site
ExpressionBacterialMutationN/AAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-hU6-NTC_sgRNA-hUbC-dCas9-KRAB-T2a-GFP
Plasmid#231025PurposeAll-in-one lentiviral vector (Gersbach lab design) for CRISPRi with non-targeting control sgRNADepositorInsertNon-targeting control sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYC2085
Plasmid#158721PurposeCRISPR system used for genome editing in Mycobacterium tuberculosis. Helper plasmid expresses Sth1 Cas9 and the cognate sgRNA, using hygromycin as a selection marker.DepositorInsertSth1 sgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
p104Tol2-tp1:Cas9-t2A-GFP, 4xU6:sgRNA
Plasmid#227773PurposeExpression of tp1 (Notch) dependent Cas9-GFP and U6-driven 4 sgRNAs in zebrafishDepositorInsertsCas9-t2A-GFP
4xU6:sgRNA
UseCRISPRPromoterU6 and tp1Available SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
p128Tol2-Olactb:Cas9-t2A-GFP, 4xU6:sgRNA
Plasmid#226834PurposeExpression of b-actin driven Cas9-GFP and U6-driven 4 sgRNAs in zebrafishDepositorInsertsCas9-t2A-GFP
4xU6:sgRNA
UseCRISPRPromoterOlactb and U6Available SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJZC603
Plasmid#62317PurposesgRNA with 2x PP7 for yeast cellsDepositorInsertsgRNA + 2x PP7 RNA binding module
ExpressionYeastPromoterSNR52Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair3
Plasmid#98974PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 37bp 3' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 3 and Cas9(D10A)
ExpressionMammalianAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTAG4E
Plasmid#176868PurposeFirst sgRNA in a tRNA separated array of sgRNAsDepositorInsertsgRNA_4E
UseCRISPRMutationWTAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTAG5
Plasmid#176869PurposeFirst sgRNA in a tRNA separated array of sgRNAsDepositorInsertsgRNA_5
UseCRISPRMutationWTAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTAG6E
Plasmid#176870PurposeFirst sgRNA in a tRNA separated array of sgRNAsDepositorInsertsgRNA_6E
UseCRISPRMutationWTAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTAG2
Plasmid#176864PurposeFirst sgRNA in a tRNA separated array of sgRNAsDepositorInsertsgRNA_2
UseCRISPRMutationWTAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only