We narrowed to 17,264 results for: REV
-
-
pPS1358
Plasmid#8918DepositorAvailable SinceAug. 19, 2005AvailabilityAcademic Institutions and Nonprofits only -
Rnq1 (153-405)-GFP
Plasmid#1170DepositorAvailable SinceJan. 21, 2005AvailabilityAcademic Institutions and Nonprofits only -
pYSD316
Plasmid#253035PurposeEncodes the MFalpha1 PrePro-app8 signal peptide, Anti-GFP nanobody, HA-tagged Aga1 deltaN181AA yeast surface display anchor protein in a yeast expression vector with pTEF1, LEU2 selectable markerDepositorInsertAnti-GFP nanobody -Aga1
ExpressionYeastAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAM90
Plasmid#226682PurposeRpn9S111TAG lid (Rpn5, MBP-HRV-Rpn6, Rpn8, Rpn9S111TAG, Rpn11)DepositorInsertsTagsMBP-HRVExpressionBacterialMutationS111TAGAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
12URA-B-ScTop2∆CTD
Plasmid#214924PurposeYeast expression vector 6xHisTag-TEV at N terminus to express S cerevisiae topoisomerase II (1–1177)DepositorInserttopoisomerase II
Tags6x His-TEVExpressionYeastMutationDeleted amino acids 1178-1428PromoterGal 1/10Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
p406 – TDH3-Elo3-GFP11-Ura
Plasmid#177734PurposeER protein Elo3 with a C-terminal, an HA tag and the eleventh β-strand of GFP in yeast plasmid with URA markerDepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDSM-de-Pfba1-PYC-Trpl15a
Plasmid#127738PurposeYeast pathway position 5. PYC transcription unit with the FBA1 promoter and RPL15A terminator.DepositorInsertpyruvate carboxylase (PYC1 Synthetic, Budding Yeast)
UseSynthetic BiologyExpressionYeastPromoterPfba1Available SinceJan. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Sc NybbR eRF3∆165N (WT)
Plasmid#175419PurposeEncodes His-MBP-TEV-ybbR-WT eRF3∆165NDepositorInserteRF3 (SUP35 Budding Yeast)
TagsHis-MBP-TEV and ybbRExpressionBacterialMutation∆165NPromoterT7Available SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only
