We narrowed to 801 results for: TRIP-1
-
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2
Plasmid#85208PurposeBackbone for lentiviral gene silencing with monomeric Kusabira-Orange2 expressionDepositorTypeEmpty backboneUseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shLuc.mKO2
Plasmid#85224PurposeshLuc (Target TTACGCTGAGTACTTCGA) for silencing luciferase gene as a control and express monomeric Kusabira-Orange2.DepositorInsertFirefly Luciferase
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shLuc
Plasmid#83092PurposeLentiviral shRNA vector for inducible knockdown of luciferase (control hairpin)DepositorInsertshLuc
UseLentiviralExpressionMammalianAvailable SinceDec. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shGFP
Plasmid#83085PurposeLentiviral shRNA vector for inducible knockdown of GFP (control hairpin)DepositorInsertshGFP
UseLentiviralExpressionMammalianAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shLacZ
Plasmid#98632PurposeLentiviral shRNA vector for inducible knockdown of LacZ (control hairpin)DepositorInsertshLacZ
UseLentiviralExpressionMammalianAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6A-EGFR ECD (1-644)
Plasmid#42666DepositorAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shLuc
Plasmid#110409PurposeshLuc (Target TTACGCTGAGTACTTCGA), silence LUC gene, blasticidin selection.DepositorInsertLuciferase
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSIRV-AP-1-mCherry
Plasmid#118095PurposeFluorescent reporter for AP-1 activationDepositorInsertmCherry
UseRetroviralPromoterminimal promoter with AP-1 responsive elementAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shGAC
Plasmid#110410PurposeshGAC (Target CCTCTGTTCTGTCAGAGTT), silence glutaminase isoform GAC, blasticidin selection.DepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1-GST-CD(Cbx7)
Plasmid#82525PurposeExpresses GST-CD (Cbx7) fusion proteins in E. coli. Cbx7 chromodomain only; amino acids 1–62.DepositorInsertChromobox Homolog 7 (CBX7 Human)
TagsGSTExpressionBacterialMutationCD(Cbx7) ; amino acids 1–62Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1-GST-ATL(Cbx7)
Plasmid#82526PurposeExpresses GST-CD (Cbx7) fusion proteins in E. coli. Cbx7 ATL region only, amino acids 66–81.DepositorInsertChromobox Homolog 7 (CBX7 Human)
TagsGSTExpressionBacterialMutationATL(Cbx7), amino acids 66–81Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shSMAD4 #2
Plasmid#83091PurposeLentiviral shRNA vector for inducible knockdown of human SMAD4DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only