We narrowed to 2,507 results for: dCas9
-
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 SIRT7_H187Y
Plasmid#53151Purposeexpression vector for catalytically inactive human Sirtuin7DepositorInsertSirt7 (SIRT7 Human)
TagsFLAGExpressionMammalianMutationH187Y, catalytic inactivePromoterCMVAvailable SinceMay 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV_dCas9-ZIM3-KRAB_sgTAOK2i_#3
Plasmid#172985PurposeCRISPRi for TAOK2DepositorAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-WT
Plasmid#222497PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to WT Dnmt3A/3L followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterEFSAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSt1374m-EF1alpha-N-NLS-DNMT3L-L-DNMT3A-L-dcas9-NLS
Plasmid#112214PurposeTargeted DNA methylationDepositorUseCRISPRTagsmCherryMutationD10A,H840A,N863AAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSt1374-N-NLS-DNMT3L-L-DNMT3A-L-dcas9-NLS
Plasmid#112210PurposeTargeted DNA methylationDepositorAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSSBIO32_dCas9_RPA3717
Plasmid#240491PurposeCRISPRi-mediated Knockdown of RPA3717DepositorInsertCas9 (cas9 Streptococcus pyogenes)
UseCRISPRExpressionBacterialMutationD10A, H840APromoterPlacAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSSBIO32_dCas9_RPA3701
Plasmid#240490PurposeCRISPRi-mediated Knockdown of RPA3701DepositorInsertCas9 (cas9 Streptococcus pyogenes)
UseCRISPRExpressionBacterialMutationD10A, H840APromoterPlacAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSSBIO32_dCas9_RPA1580
Plasmid#240488PurposeCRISPRi-mediated Knockdown of RPA1580DepositorInsertCas9 (cas9 Streptococcus pyogenes)
UseCRISPRExpressionBacterialMutationD10A, H840APromoterPlacAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_dCas9-XTEN-KRAB-p2A-mCherry
Plasmid#222107PurposeDonor vector for CRISPRi integration at AAVS1 with an mCherry fluorophoreDepositorInsertCRISPRi-kox1(KRAB) (cas9 Human, S. pyogenes)
UseAAV and CRISPRTagsHA and P2A-mCherryExpressionMammalianMutationD10A, H840AAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV_dCas9-ZIM3-KRAB_sgTAOK2i_#2
Plasmid#172984PurposeCRISPRi for TAOK2DepositorAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9-KRAB_sgRNA Td2
Plasmid#176264PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged to the KRAB domain and Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZLCv2-gMYOD1-3xFLAG-dCas9-HA-2xNLS
Plasmid#106355PurposeCRISPR/Cas9 engineered chromatin immunoprecipitation of MYOD1 locusDepositorInsertMYOD1 gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
FUGW U6 gLacZ dCas9-KRAB-T2a-GFP
Plasmid#234883Purposenon-targeting CRISPRi controlDepositorInsertL1HS gRNA
UseCRISPR and LentiviralTagsGFPExpressionMammalianAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-NOG(AtUBI10)-MTAP-LUC
Plasmid#234371PurposeT-DNA vector for expression of the the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAs, no gRNA included (NOG)DepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis Ubi10 and MTAP1 (synthetic)Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td2
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td1
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZLCv2-gD4Z4-1-3xFLAG-dCas9-HA-2xNLS
Plasmid#106352PurposeCRISPR/Cas9 engineered chromatin immunoprecipitation of D4Z4 locusDepositorInsertD4Z4 gRNA-1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZLCv2-gD4Z4-3-3xFLAG-dCas9-HA-2xNLS
Plasmid#106354PurposeCRISPR/Cas9 engineered chromatin immunoprecipitation of D4Z4 locusDepositorInsertD4Z4 gRNA-3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSt1374-N-NLS-DNMT3L-L-DNMT3Amut-L-dcas9-NLS
Plasmid#112209PurposeTargeted DNA methylationDepositorAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only