We narrowed to 14,352 results for: Cas9
-
Plasmid#120555PurposeExpress Cas9, 2xNES, 2 tandem ERT2 and GCN4 in mammalian cellsDepositorInsertCas9, NES, ERT2 and GCN4
UseLentiviralExpressionMammalianAvailable sinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
PET-B-Sniper SpCas9-NLS-6xHis
Plasmid#207377PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInsertB-Sniper SpCas9
UseCRISPRTags6xHisExpressionBacterialMutationF539S, M763I, K890N, amino acids 1005-1013 replac…PromoterT7Available sinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMLS544
Plasmid#188882PurposeIntegrating Pmex-5::Cas9 expression vectorDepositorInsertPmex-5::Cas9
ExpressionWormMutationC. elegans codom optimization and intron additionAvailable sinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMLS546
Plasmid#188883PurposeIntegrating Pmex-5::Cas9 expression vectorDepositorInsertPmex-5::Cas9
ExpressionWormMutationC. elegans codom optimizationAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable sinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
eGFPbait-E2A-KalTA4-pA donor vector
Plasmid#61069Purposefor CRISPR/Cas9 mediated insertion of E2A-KalTA4; to be used in combination with a eGFP specific sgRNA (e.g. Plasmid 61051)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertseGFPbait
KalTA4
UseZebrafish expressionTagsE2AAvailable sinceFeb. 12, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pG2
Plasmid#162603PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable sinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXPR_206
Plasmid#96920Purposefor SaCas9 knockout, lentiviral expression of S. aureus Cas9 (SauCas9) and gRNA scaffoldDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable sinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pIVTR(T7A)-Cas9-T2A-mClover3
Plasmid#172293PurposeIn vitro transcription of Cas9-T2A-mClover3 synthetic constructDepositorInsertCas9-T2A-mClover3
UseCRISPRPromoterT7 promoter A-initiatingAvailable sinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIVT-dCas9-EGFP
Plasmid#174442Purposein vitro transcription template for dCas9-EGFPDepositorInsertCas9 Endonuclease Dead
UseIn vitro transcription templateTagsEGFPPromoterT7 SP6Available sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-mCherry-P2A-Cre-WPRE
Plasmid#107312PurposeEncoding hSyn-mCherry-CreDepositorHas serviceAAV1InserthSyn-mCherry-P2A-Cre-WPRE
UseAAVExpressionMammalianAvailable sinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pG3B-U6SC
Plasmid#134753PurposepGreen3 CRISPR/Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCRISPR/Cas9
UseCRISPRPromotergRNA-U6, zCas9-35SCAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
CBE6b-NRCH
Plasmid#257827PurposeCBE6b Sp Cas9 NRCH IVT plasmidDepositorInsertCBE6b SpCas9 NRCH
ExpressionMammalianAvailable sinceJune 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
PET-Blackjack SpCas9-NLS-6xHis
Plasmid#207375PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInsertBlackjack SpCas9
UseCRISPRTags6xHisExpressionBacterialMutationamino acids 1005-1013 replaced with two glycinePromoterT7Available sinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-Csy4
Plasmid#161763PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x Csy4-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-tRNA
Plasmid#161762PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td2
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td1
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA#1
Plasmid#64245Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-hSyn-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177345PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from Synapsin promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterSynapsinAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only