We narrowed to 16,546 results for: OMP;
-
Plasmid#98826PurposeIn vivo visualization of microtuble plus ends (can be used for colocalization studies)DepositorInsertEB3
TagsmScarlet-IExpressionMammalianPromoterCMVAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1-14-3-3 gamma GST
Plasmid#13280DepositorAvailable SinceOct. 7, 2006AvailabilityAcademic Institutions and Nonprofits only -
pBEVY-GL
Plasmid#51225Purposebi-directional expression vector for yeast, galactose inducible, LEU2 selectionDepositorTypeEmpty backboneExpressionYeastPromoterGAL1,10Available SinceMarch 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDAC446
Plasmid#195239PurposeMammalian expression of Csm complex from separate promoters; GFP backbone (Used for RNA knockdown)DepositorInsertFLAG-NLS-Csm1; FLAG-NLS-Csm2; FLAG-NLS-Csm3; FLAG-NLS-Csm4; FLAG-NLS-Csm5; FLAG-NLS-Cas6; crRNA; GFP
ExpressionMammalianAvailable SinceJan. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRVGP
Plasmid#15377DepositorInsertd2EGFP
UseRetroviralExpressionMammalianAvailable SinceApril 18, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-BFP (AAV8)
Viral Prep#137130-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Ef1a-Con/Foff 2.0-BFP (#137130). In addition to the viral particles, you will also receive purified pAAV-Ef1a-Con/Foff 2.0-BFP plasmid DNA. EF1a-driven, Cre-dependent expression of BFP (inhibited in the presence of Flp recombinase). These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsBFP (Cre-dependent)Available SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPP444
Plasmid#158802PurposePlasmid containing Homo sapiens codon optimized CasΦ-3 and a SapI-GG stuffer spacer for editing in human cells.DepositorInsertCasPhi-3
ExpressionMammalianAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
Human Bcl-2/pcDNA3
Plasmid#19279DepositorInserthuman Bcl-2 (BCL2 Human)
ExpressionMammalianAvailable SinceSept. 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc3-Tsc1
Plasmid#19955DepositorAvailable SinceApril 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
pN3-Control
Plasmid#24544DepositorTypeEmpty backboneExpressionMammalianAvailable SinceMay 10, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGP-AAV-syn-FLEX-jGCaMP7c variant 1513-WPRE (AAV1)
Viral Prep#105322-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-jGCaMP7c variant 1513-WPRE (#105322). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7c variant 1513-WPRE plasmid DNA. Synapsin-driven, Cre-dependent jGCaMP7c expression. jGCaMP7c exhibits high contrast between peak fluorescence and resting fluorescence. It is useful for activity imaging of large populations of densely-labeled neurons because background fluorescence from inactive neurons is reduced. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-ChR2-EYFP (AAV8)
Viral Prep#137163-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-nEF-Con/Foff 2.0-ChR2-EYFP (#137163). In addition to the viral particles, you will also receive purified pAAV-nEF-Con/Foff 2.0-ChR2-EYFP plasmid DNA. nEF-driven, Cre-dependent expression of ChR2-EYFP for optogenetic activation (inhibited in the presence of Flp recombinase). These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsEYFP (Cre-dependent)Available SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-GCaMP6M (AAV8)
Viral Prep#137120-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Ef1a-Con/Foff 2.0-GCaMP6M (#137120). In addition to the viral particles, you will also receive purified pAAV-Ef1a-Con/Foff 2.0-GCaMP6M plasmid DNA. EF1a-driven expression of GCaMP6m in the presence of Cre recombinase (inhibited in the presence of Flp recombinase). These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
mTurquoise2-Giantin
Plasmid#129630PurposeIn vivo visualization of the Golgi apparatus (can be used for colocalization studies)DepositorInsertmTurquoise2-Giantin
ExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
F-Cdk8
Plasmid#15366DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBEVY-GU
Plasmid#51229Purposebi-directional expression vector for yeast, galactose inducible, URA3 selectionDepositorTypeEmpty backboneExpressionYeastPromoterGAL1,10Available SinceMarch 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
hRIP3 GFP D160N
Plasmid#41386DepositorInsertRIP3 (RIPK3 Human)
TagsGFPExpressionMammalianMutationKinase Domain Mutant (D160N)PromoterCMVAvailable SinceDec. 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
myc-hULK2
Plasmid#31966DepositorAvailable SinceSept. 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gαs-LgB113
Plasmid#134362PurposeNanoluc complementation assay. Expression of Gαs protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 113 and 114 of Gαs. Addition of the HA epitope at N terminus of Gαs.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only