We narrowed to 7,749 results for: lentivirus vector
-
Plasmid#216089PurposeCas9 [Sp] CRISPRa targeting CD47, positive controlDepositorInsertCD47 guide
UseCRISPR and Lentiviral; Positive controlsAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT3_mCherry2-NLS-PEST_Puro
Plasmid#213771PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT3_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-EFS_mCherry2-NLS-PEST_Puro
Plasmid#213775PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertEFS_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-RAB10 T23N-WPRE-UbC-Emerald
Plasmid#203802PurposeLentiviral vector plasmid expressing human RAB10 mutation T23N (dominant negative mutant) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable sinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-RAB10-WPRE-UbC-Emerald
Plasmid#203804PurposeLentiviral vector plasmid expressing human RAB10 under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable sinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-LucAL
Plasmid#174049PurposeExpresses mALG8 (ITYTWTRL) and mLAMA4 (VGFNFRTL) antigens as a fusion to luciferase and Cre recombinaseDepositorInsertLucAL
UseCre/Lox, Lentiviral, and LuciferaseTagsLuciferaseExpressionMammalianMutationALG8 alanine 506 to threonine; LAMA4 glycine 1254…PromoterHuman Ubiquitin CAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
dnCEBP: pLenti-TRE-A-C/EBP-PGK-rtTAA-2A-Puro
Plasmid#177201Purposeencoding a dominant negative form of CEBP under inducible promoterDepositorPublicationInsertdnCEBP (A-C/EBP)
UseLentiviralExpressionMammalianPromoterTREAvailable sinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP201-Lenti-TRE3G-Flag-GluN2B-WPRE-pA
Plasmid#164775PurposepLenti vector backbone designed to express Flag-GluN2B from a TRE3G promoter.DepositorInsertGluN2B
UseLentiviralTagsFlagAvailable sinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP228-Lenti-CMV-GFP-GluN2B-WPRE-pA
Plasmid#84277PurposepLenti vector backbone designed to express GFP tagged GluN2B from a CMV promoter.DepositorInsertGluN2B
UseLentiviralTagsGFPPromoterCMVAvailable sinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα-RIIαWT-IRES-EGFP
Plasmid#183456PurposeReplacement of endogenous rat PKA-RIIα subunits with wild-type RIIαDepositorInsertsgRNA and Prkar2a (Prkar2a Rat)
UseLentiviralMutationshRNA-resistant mutations: C135>G, G138>A, …PromotershRNA: H1 / gene: ubiquitinAvailable sinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP227-Lenti-CMV-GFP-GluN2A-WPRE-pA
Plasmid#84276PurposepLenti vector backbone designed to express GFP tagged GluN2A from a CMV promoter.DepositorInsertGluN2A
UseLentiviralTagsGFPPromoterCMVAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP200-Lenti-TRE3G-Flag-GluN2A-WPRE-pA
Plasmid#164724PurposepLenti vector backbone designed to express Flag-GluN2A from a TRE3G promoter.DepositorInsertGluN2A
UseLentiviralTagsFlagAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP211-Lenti- (MCS)-WPRE-pA
Plasmid#63083Purposeplenti vector containing MCS-WPRE-pA. Contains no promoter.DepositorTypeEmpty backboneUseLentiviralAvailable sinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP216-Lenti-1.3CaMKIIa P-GFP-WPRE-pA
Plasmid#62926PurposepLenti vector backbone designed to express GFP from a 1.3CaMKIIa promoter.DepositorInsertGreen Fluorescent protein (GFP)
UseLentiviralPromoter1.3αCaMKIIAvailable sinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP214-Lenti-0.5Synapsin P-GFP- WPRE-pA
Plasmid#62929PurposepLenti vector backbone designed to express GFP from a 0.5Synapsin promoter.DepositorInsertGreen Fluorescent protein (GFP)
UseLentiviralPromoter0.5synapsin and 1.3αCaMKIIAvailable sinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP213-Lenti-1.1Synapsin P-GFP-WPRE-pA
Plasmid#62930PurposepLenti vector backbone designed to express GFP from a 1.1Synapsin promoter .DepositorInsertGreen Fluorescent protein (GFP)
UseLentiviralPromoter1.1Synapsin and 1.3αCaMKIIAvailable sinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-H1-SGIBX
Plasmid#174843Purposeempty vector for cloning shRNA and/or miRNADepositorTypeEmpty backboneUseLentiviral and RNAiExpressionMammalianAvailable sinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-H1-SX
Plasmid#174845Purposeempty vector for cloning shRNA and/or miRNADepositorTypeEmpty backboneUseLentiviral and RNAiExpressionMammalianAvailable sinceOct. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1C-YFP-shSCR
Plasmid#139647PurposeReplacing the RSV promoter of pLKO.1 with the CMV promoter improves lentiviral production with third-generation viral packaging system.DepositorInsertshSCR
UseLentiviral and RNAiExpressionMammalianMutationSee Depositor commentsPromoterCMVAvailable sinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by