We narrowed to 10,395 results for: EPO;
-
Plasmid#227139PurposeBarcoded assay, Ca2+ sensor; barcode BC0524DepositorInsert6x clustered NFAT element linked to CMV minimal promoter driving barcode 0524 and a luciferase reporter gene
ExpressionMammalianAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
Rlucrarr3-Flash1
Plasmid#74129PurposeFlAsH-BRET reporter to monitor conformational changes in Arrestin3. Insertion of FlAsH motif (CCPGCC) following amino acid residue 40 of Arrestin3.DepositorInsertArrestin3
TagsRenilla luciferase (rLuc)ExpressionMammalianMutationInsertion of FlAsH motif (CCPGCC) following amino…Available SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
Rlucrarr3-Flash4
Plasmid#74132PurposeFlAsH-BRET reporter to monitor conformational changes in Arrestin3. Insertion of FlAsH motif (CCPGCC) following amino acid residue 225 of Arrestin3.DepositorInsertArrestin3
TagsRenilla luciferase (rLuc)ExpressionMammalianMutationInsertion of FlAsH motif (CCPGCC) following amino…Available SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Rlucrarr3-Flash3
Plasmid#74131PurposeFlAsH-BRET reporter to monitor conformational changes in Arrestin3. Insertion of FlAsH motif (CCPGCC) following amino acid residue 171 of Arrestin3.DepositorInsertArrestin3
TagsRenilla luciferase (rLuc)ExpressionMammalianMutationInsertion of FlAsH motif (CCPGCC) following amino…Available SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEND-164_Cacnes_pFAST
Plasmid#225616PurposeReplicative vector for anaerobic fluorescent reporter protein FAST tag strong constitutive recombinant expression in C. acnes. pBRESP36A with P(BBa_J23119)+RBS_1+pFAST.DepositorInsertpFAST
UseSynthetic BiologyTags6xHisExpressionBacterialMutationCodon optimized for Cutibacterium acnesAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-anti-VEGF(Nb35) PAGER(TF)
Plasmid#230000PurposeExpresses anti-VEGF PAGER(TF) in mammalian cells; used with NanoLuc-Arrestin-TEVp (Addgene #125228) and UAS-Firefly Luciferase reporter (Addgene #104840)DepositorInsertIL2SP-Aro6-Nb35-TEVcs-ALFA-KORD(RAA)-LOV-TEVcs-Gal4
UseAAVExpressionMammalianMutationV360A/R361A on KORDPromoterCMVAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7f-5p
Plasmid#103156PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7f-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7f-5p target
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
TPC2-D276K-G-GECO1.2
Plasmid#207142PurposeFusion of Ca2+ reporter and pore-dead lysosomal Ca2+-permeable channelDepositorInsertTPC2N2 (TPCN2 Human)
TagsG-GECO1.2ExpressionMammalianMutationChanged Aspartate 276 to LysinePromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO Dual-Luciferase-PDAP1-3'UTR-Mut4x
Plasmid#182256PurposeHuman PDAP1 3` UTR region mutated in 4x binding site for miR-150 cloned downstream of luciferase reporter geneDepositorInsert3' UTR region of PDAP1 gene mutated in 4 binding sites for mir-150
UseLuciferaseExpressionMammalianAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only