We narrowed to 3,049 results for: erf
-
Plasmid#69023PurposeExpresses rat Cx43 (Gja1 CDS) truncated at amino acid 258 and tagged with msfGFP on the C-terminus. CMV promoter.DepositorInsertCx43 (Gja1 Rat)
TagsV206K monomerized super folder GFPExpressionMammalianMutationdelete codons 258-381 and fuse in frame to monome…PromoterCMVAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pWZL Hygro-NFLAG TRF1 deltaA
Plasmid#16278DepositorInserthTRF1 (TERF1 Human)
UseRetroviralTagsFlagExpressionMammalianMutationDeleted acidic domain (aa1-66)Available SinceMay 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a myc tagged mbIL2 IRES miRFP720-P2A-Blast
Plasmid#248031PurposeConstitutively expresses myc tagged membrane bound IL2, miRFP720 and a blasticidin resistance gene in human cellsDepositorInsertmyc-tagged membrane bound IL2 (IL2 Human)
UseLentiviralExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v2.2-sfGFP
Plasmid#149665PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 2.2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWZL Hygro-NFLAG TRF1 deltaM
Plasmid#16281DepositorInserthTRF1 (TERF1 Human)
UseRetroviralTagsFlagExpressionMammalianMutationDeleted myb domain (aa379-439)Available SinceMay 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-Flag-SOD1-G93A
Plasmid#235662PurposeExpress human SOD1-G93A in mammalian cellsDepositorInsertSOD1-G93A (SOD1 Human)
TagsFlag-tag at N-terminalExpressionMammalianMutationchanged Glycine 93 to alaninePromoterCMV promoterAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HCMVgO-sfGFP (Merlin)
Plasmid#136452PurposeMammalian expression plasmid for HCMV glycoprotein O (Merlin strain) fused to superfolder GFPDepositorInsertglycoprotein O (UL74 Human betaherpesvirus 5)
TagsGly/Ser-rich linker (GGSGGSGSGG) (includes BamHI …ExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNAM-human eIF2C1-WT-Myc
Plasmid#50360PurposeExpression of human eIF2C1 in mamalian cellsDepositorAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pWZL Hygro-NFLAG TRF1 deltaA deltaM
Plasmid#16297DepositorInserthTRF1 (TERF1 Human)
UseRetroviralTagsFlagExpressionMammalianMutationDeleted acidic domain (aa1-66) and myb domain (aa…Available SinceMay 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
-
pPGK-T7/2-CD44v3 (-cyt)
Plasmid#137813Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v3 (-cyt) (CD44 Human)
TagsGFPExpressionMammalianMutationwithout cytoplasmic region, N280D in the V3 regionPromoterPGKAvailable SinceJune 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBig2ab zz TEV YBBR POT1 ZZ TEV TPP1 MBP TEV TIN2 ZZ TEV TRF1 (4comp1)
Plasmid#185447PurposeCoexpresses human POT1 with a zz affinity tag, YBBR site, and TEV site, human TRF1 and TPP1 each with a zz tag and TEV site, and human TIN2 with an MBP affinity tag and TEV site in insect cellsDepositorTagsMBP, YBBR, and ZZExpressionInsectAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFORF1833
Plasmid#142862PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
SLC9A3R1
Plasmid#38928PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMRS-GFP
Plasmid#220197Purposemini-Tn7 GFP expression vectorDepositorInsertmonomeric superfolder green fluorescent protein
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpromoterlessAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRS-BG35-GFP
Plasmid#220201Purposemini-Tn7 GFP expression vector - pBG35 promoterDepositorInsertmonomeric superfolder green fluorescent protein
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpBG35Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Antibody#241895-rAbPurposeAnti-Netrin 1 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes human and mouse Netrin 1. Does not cross-react with other netrins.DepositorArticleRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceDec. 17, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Strain Phi80 JQ929582
Bacterial Strain#38203DepositorBacterial ResistanceKanamycinSpeciesSyntheticAvailable SinceJuly 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV pTRE-FSF-FLEX-EGFP-WPRE-bGHpA (AAV1)
Viral Prep#65453-AAV1PurposeReady-to-use AAV1 particles produced from AAV pTRE-FSF-FLEX-EGFP-WPRE-bGHpA (#65453). In addition to the viral particles, you will also receive purified AAV pTRE-FSF-FLEX-EGFP-WPRE-bGHpA plasmid DNA. TRE-driven, Cre and Flp-dependent expression of EGFP. These AAV preparations are suitable purity for injection into animals.DepositorPromotertetOTagsEGFP (Cre and Flp-dependent)Available SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only