We narrowed to 5,950 results for: paav
-
Plasmid#208660PurposeExpresses the genetically-encoded fluorescent corticotropin-releasing factor (CRF) sensor GRAB_CRF0.5 in a cre-dependent mannerDepositorInsertGPCR activation based corticotropin-releasing factor (CRF) sensor GRAB_CRF0.5
UseAAVTagsExpressionMutationPromoterhSynAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-jAspSnFR3-mRuby3
Plasmid#203459PurposejAspSnFR3-mRuby3 in adenoviral expression vectorDepositorInsertjAspSnFR3
UseAAV and AdenoviralTagsHis-tag and mRuby3ExpressionMammalianMutationPromoterCAGAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MP-84-spCas9-U6-gRNA-tlock
Plasmid#206936PurposeExpression of spCas9 endonuclease and gRNA in an AAV vector allowing packaging of viral genome smaller than 5 kb.DepositorInsertspCas9
UseAAVTagsSV40 NLSExpressionMammalianMutationPromoterMP-84Available SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tbg-CES2C-ΔC-S230A
Plasmid#200561PurposeSecreted mouse CES2C S230A mutant driven by heptaocyte-specific promoter in AAV viral vectorDepositorInsertMouse Carboxylesterase 2C S230A mutant delta C-terminal (Ces2c Mouse)
UseAAVTagsFlagExpressionMutationPromoterTBG promoterAvailable SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVss-U6-sgHTT51-7sk-Cas9
Plasmid#190901PurposeAAV-KamiCas9 vector expressing sgGFP and mouse HTT sgRNADepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV/EF1a::DIO-iLMO2
Plasmid#129482PurposeAAV2 transfer plasmid for Cre-dependent expression of iLMO2, an opto-chemogenetic probe for neuronal inhibition by light or chemicalDepositorInsertiLMO2
UseAAVTagsExpressionMammalianMutationPromoterEF1aAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FRISZ-GPI
Plasmid#177264PurposeAAV transfer plasmid for cell-surface-localized FRISZ (via CD59 GPI) under hSyn promoterDepositorInsertCD59 leader-FRISZ-GPI
UseAAVTagsCD59 GPI and CD59 leader sequenceExpressionMutationPromoterhSynAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-2X(CMV-eBFP2-3XNLS-pA)
Plasmid#195867Purposeto express nuclear localized eBFP2DepositorInserteBFP2
UseAAVTagsExpressionMutationPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVTagsExpressionMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-miniSOG-C-Far
Plasmid#193914PurposeControl plasmid that expresses miniSOG targeted to the cell membrane in mammalian cellsDepositorInsertminiSOG
UseAAVTagsFarnesylation signal sequence and Flag tagExpressionMammalianMutationPromoterCAGAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-UbC-3xNLS-mScarlet-I
Plasmid#191099PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-mScarlet-I
UseAAV and Synthetic BiologyTagsThree repeats of the nuclear localizzation seque…ExpressionMammalianMutationoptimized to human codon usagePromoterUbCAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgKcna2
Plasmid#192796PurposeEncodes SaCas9 and an sgRNA targeting mouse Kcna2DepositorInsertsgKcna2
UseAAV and CRISPRTagsExpressionMutationPromoterU6Available SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgKcna6
Plasmid#192797PurposeEncodes SaCas9 and an sgRNA targeting mouse Kcna6DepositorInsertsgKcna6
UseAAV and CRISPRTagsExpressionMutationPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-FRT-2xtTA
Plasmid#191205PurposeFlpo dependent tTA expression under the control of TRE promotorDepositorInsert2xtTA
UseAAVTagsExpressionMammalianMutationPromoterTREAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TetO(3G)-GCaMP6f-WPRE
Plasmid#186205PurposeExpress GCaMP6f under TetO(3G)DepositorInsertGCaMP6f
UseAAVTags6xHis (N terminal on insert), T7 epitope, and Xpr…ExpressionMutationPromoterTetO(3G)Available SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-SynaptoZip
Plasmid#177318PurposeAAV expression of the synaptic activity-marker SynaptoZip fused to mCherry driven by human Synapsin promoterDepositorInsertmCherry-SynaptoZip (Vamp2 Rat)
UseAAVTagsMyc and mCherryExpressionMammalianMutationPromoterhSynAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-ChR2-YFP
Plasmid#178722PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of ChR2-YFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertChR2-YFP
UseAAVTagsExpressionMutationPromoterAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-ChR2-YFP
Plasmid#178723PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of ChR2-YFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertChR2-YFP
UseAAVTagsExpressionMutationPromoterAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-ChR2-YFP
Plasmid#178724PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVTagsExpressionMutationPromoterAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6-ChR2-YFP
Plasmid#178726PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVTagsExpressionMutationPromoterAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only