We narrowed to 18,793 results for: ERG
-
Plasmid#118360PurposeThis plasmid expresses the full length human SUMO1.DepositorAvailable SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pLenti.CMV/TO_PRKAA2
Plasmid#74447PurposeLentiviral expression vector encoding untagged WT human AMPK alpha 2DepositorAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-dTom
Plasmid#178718PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of dTom in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertdTom
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-DEST-FASCIN
Plasmid#31207DepositorAvailable SinceJuly 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-VTKS1-hChR2-tBFP
Plasmid#178706PurposeAAV vector for transgene expression of hChR2-tBFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInserthChR2-tBFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Gata3
Plasmid#70270PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Gata3DepositorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Ascl2
Plasmid#71151PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Ascl2/Mash2DepositorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Ets2
Plasmid#70272PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Ets2DepositorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only