We narrowed to 8,899 results for: chloramphenicol
-
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
POC1535
Plasmid#226476PurposepMOLC360_VL_I1 (Chloramphenicol R) containing the insert I1 to be assembled in POC1518 (pMOBK360_VL) using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1536
Plasmid#226477PurposepMOLC360_VM_I2 (Chloramphenicol R) containing the insert I2 to be assembled in POC1518 (pMOBK360_VL) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1537
Plasmid#226478PurposepMOLC360_VM_I3 (Chloramphenicol R) containing the insert I3 to be assembled in POC1518 (pMOBK360_VL) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1538
Plasmid#226479PurposepMOLC360_VR_I4 (Chloramphenicol R) containing the insert I4 to be assembled in POC1518 (pMOBK360_VL) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1539
Plasmid#226480PurposepMOLC360_VL_I5 (Chloramphenicol R) containing the insert I5 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1540
Plasmid#226481PurposepMOLC360_VM_I6 (Chloramphenicol R) containing the insert I6 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1541
Plasmid#226482PurposepMOLC360_VR_I7 (Chloramphenicol R) containing the insert I7 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1542
Plasmid#226483PurposepMOLC360_VL_I8 (Chloramphenicol R) containing the insert I8 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1543
Plasmid#226484PurposepMOLC360_VR_I9 (Chloramphenicol R) containing the insert I9 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1544
Plasmid#226485PurposepMOLC360_VL_I10 (Chloramphenicol R) containing the insert I10 to be assembled in POC1520 (pMOBK360_VR) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1545
Plasmid#226486PurposepMOLC360_VR_I11 (Chloramphenicol R) containing the insert I11 to be assembled in POC1520 (pMOBK360_VR) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJethlpAmTurquoise2Cm
Plasmid#206822PurposeTemplate for hlpA-mTurquoise2 amplification associated with chloramphenicol resistance geneDepositorInserthlpA
UseSynthetic BiologyTagsmTurquoise2Available SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJethlpAmKate2Cm
Plasmid#206810PurposeTemplate for hlpA-mkate2 amplification associated with chloramphenicol resistance geneDepositorInserthlpA
UseSynthetic BiologyTagsmKate2Available SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
PtetA with pBELO_L6-PT3-T4_CAMR_TAN+
Plasmid#225644PurposetetA promoter expressing mCherry with pBELO_L6-PT3-T4 backbone and chloramphenicol resistanceDepositorInserttetR/tetA
TagsmCherryExpressionBacterialPromotertetA promoterAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLac0301 with pBELO_L6-PT3-T4_CAMR_TAN+
Plasmid#225643PurposeLac0301 promoter expressing mCherry with pBELO_L6-PT3-T4 backbone and chloramphenicol resistanceDepositorInsertLacO3O1
TagsmCherryExpressionBacterialPromoterLacO3O1 promoterAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only