We narrowed to 7,002 results for: tac
-
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-hCD24-T2A-GFP
Plasmid#205456Purposelentiviral plasmid for expression of human CD24DepositorAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Prig-3::CD4::spGFP11
Plasmid#65830PurposeFor membrane contactDepositorInsertHomo sapiens CD4 molecule (CD4), transcript variant 2, mRNA (CD4 Human)
TagsspGFP11ExpressionWormPromoterPrig-3Available SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYTRW22K_7Ti1
Plasmid#177293Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcR and LacZDepositorInsertlacZ
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-mPD-L1-T2A-GFP
Plasmid#205455Purposelentiviral plasmid for expression of mouse PD-L1DepositorAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYTRW09K_0T5
Plasmid#177281Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with TcRDepositorInsertPtet-tetA(C)
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-mCD24-T2A-GFP
Plasmid#205448Purposelentiviral plasmid for expression of mouse CD24DepositorAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-Qa1 SCT-T2A-GFP
Plasmid#205453Purposelentiviral plasmid for expression of mouse Qa1 SCTDepositorAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-mCD55-T2A-GFP
Plasmid#205450Purposelentiviral plasmid for expression of mouse CD55DepositorAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-memRFP-3xPax7gRNA
Plasmid#224569PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and membrane RFP reporter.DepositorInsertmRFP1
UseCRISPRTagsMembrane localization signalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-hCD46-T2A-GFP
Plasmid#205457Purposelentiviral plasmid for expression of human CD46DepositorAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (FANCC)
Plasmid#180192PurposeAAV vector carrying a guide RNA targeting the human FANCC mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops
UseAAVExpressionMammalianPromoterHuman U6Available SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV:: HA-hM4Dnrxn
Plasmid#52525PurposeExpresses N-terminal HA tagged hM4DnrxnDepositorAvailable SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFSynW Substance P-pHluorin IRES mRuby3
Plasmid#195699PurposeLentiviral plasmid encoding first 68 residues of mouse preprotachykinin with a C-terminal pHluorin tag followed by an internal ribosomal entry site followed by mRuby3 under the human synapsin promoterDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7529 pHR (hU6-crLPT-EFS-PuroR-WPRE)
Plasmid#214877PurposeLentiviral vector encoding RfxCas13d targeting LPT guide arrayDepositorInserthU6-crLPT-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-Crry-T2A-GFP
Plasmid#205452Purposelentiviral plasmid for expression of mouse CrryDepositorAvailable SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
49535-sgFMR1_E3B
Plasmid#157783PurposeExpresses a sgRNA targeting the 3rd exon of human FMR1 geneDepositorAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
49535-sgFMR1_E17A
Plasmid#157782PurposeExpresses a sgRNA targeting stop codon of human FMR1 geneDepositorAvailable SinceMarch 30, 2021AvailabilityAcademic Institutions and Nonprofits only