We narrowed to 2,511 results for: control GFP
-
-
phTERT-cp PS Intein tTA
Plasmid#242032PurposeBlue-light-controlled, hTERT-promoter-driven release of the tTA transactivator from cytoplasm to nucleus.DepositorInsertCp PS Intein tTA
ExpressionMammalianMutationThe CMV promoter was replaced with the hTERT prom…PromoterhTERTAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
pRBBm34
Plasmid#48114PurposeExpression of the gfp gene under control of the native xylose inducible promoter of Bacillus megateriumDepositorInsertgfp
UseSynthetic BiologyExpressionBacterialAvailable SinceOct. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUASTattB-2xFlag-mCherry-Msp300KASH
Plasmid#170807PurposeExpresses Msp300 KASH domain fused to 2xFLAG and mCherry under Gal4/UAS control for Drosophila transgenesisDepositorInsert2xFLAG/mCherry-Msp300KASH
Tags2xFLAG-mCherry and Msp300KASHExpressionInsectPromoter5xUAS + hsp70 minimal promoterAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJWV25
Plasmid#61045PurposeTo construct N-terminal GFP fusions under control of a Zn2+ inducible promoter, integrates via double crossover at bgaADepositorTypeEmpty backboneUseSynthetic BiologyTagsGFP+ExpressionBacterialAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPotef-LN22*-3xGNLS-cbx
Plasmid#86780PurposeExpresses lambda N protein fused to triple Gfp coupled to an NLS sequence under the control of the constitutively active Potef promotor.DepositorInsertLN*
UseUstilago maydis expressionTagsGfpExpressionBacterialPromoterPotefAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-PS Intein
Plasmid#242020PurposeAAV version of PS Intein palsmid.DepositorInsertPS Intein
UseAdenoviralTagsmEGFPExpressionMammalianPromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNF-KB-Split PS Intein-C tTA
Plasmid#242035PurposeC-terminal segment of a blue-light-controlled split PS Intein tTA gene expression system, co-expressing mCherry under an NF-KB-inducible promoterDepositorInsertSplit PS Intein-C tTA
TagsmCherryExpressionMammalianMutationThe CMV promoter in the original vector was repla…PromoterNF-KBAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
pEutRwc
Plasmid#216334PurposeAn IPTG-inducible promoter controlling expression of eutR; PEutS, extended controlling expression of sfgfpDepositorInsertsEutR
Superfolder green fluorescent protein
ExpressionBacterialAvailable SinceDec. 23, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJBL6721
Plasmid#139152PurposePDNsp1 - TARGET8 - sfGFPDepositorInsertsfGFP
ExpressionBacterialMutationN/AAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJBL6722
Plasmid#139153PurposePstabilized - TARGET8 - sfGFPDepositorInsertsfGFP
ExpressionBacterialMutationN/AAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMX229
Plasmid#23002DepositorAvailable SinceFeb. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
JBL6401
Plasmid#183838PurposesfGFP reporter under the control of WT E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch regulated sfGFP
ExpressionBacterialPromoterJ23119 - Anderson PromoterAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAP-U2-3
Plasmid#236474PurposePlasmid for integration at the native URA3 locus with 3xmCherry under control of the ScACT1 promoter and 3xGFP under control of the ApACT1 promoter.DepositorInsertscACT1p-3xmCherry apACT1p-3xGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAP-U2-4
Plasmid#236475PurposePlasmid for integration at the native URA3 locus with 3xmCherry under control of the ScACT1 promoter and 3xGFP under control of the ApTUB1 promoter.DepositorInsertscACT1p-3xmCherry apTUB1p-3xGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only
