We narrowed to 3,140 results for: cat.3
-
Plasmid#72963PurposeLevel 0 - J23100 standard iGEM promoter (5' CTAT/3' GTAC fusion)DepositorInsertJ23100 promoter
UseSynthetic BiologyTagsExpressionMutationCAT gene - C435G (nucleotide) - silent mutagenesi…PromoterAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-pET-RBS
Plasmid#72981PurposePET RBS - derived from pET vectors (5' GTAC/3' CATA fusion)DepositorInsertpET RBS derived from pET vectors
UseSynthetic BiologyTagsExpressionMutationCAT gene - C435G (nucleotide) - silent mutagenesi…PromoterAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-J23108
Plasmid#72964PurposeLevel 0 - J23108 standard iGEM promoter (5' CTAT/3' GTAC fusion)DepositorInsertJ23108 promoter
UseSynthetic BiologyTagsExpressionMutationCAT gene - C435G (nucleotide) - silent mutagenesi…PromoterAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-J23114
Plasmid#72965PurposeLevel 0 - J23114 standard iGEM promoter (5' CTAT/3' GTAC fusion)DepositorInsertJ23114 promoter
UseSynthetic BiologyTagsExpressionMutationCAT gene - C435G (nucleotide) - silent mutagenesi…PromoterAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-T7_RBS
Plasmid#72978PurposeT7 promoter and RBS - derived from pET3a (5' CTAT/3' CATA) fusion)DepositorInsertT7+RBS
UseSynthetic BiologyTagsExpressionMutationCAT gene - C435G (nucleotide) - silent mutagenesi…PromoterAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-Strep(II)
Plasmid#72984PurposeStreptavidin(II) N-terminal tag (5' TAAA/3' CATA fusion)DepositorInsertStrep(II) N-terminal tag
UseSynthetic BiologyTagsExpressionMutationCAT gene - C435G (nucleotide) - silent mutagenesi…PromoterAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-lacZ
Plasmid#72948PurposeEntry vector for Bioparts - Oligo anneal or PCR with internal BsaI sites at 5' and 3' ends using NdeI/SphI cloningDepositorInsertLevel 0 - Bioparts
UseSynthetic BiologyTagsExpressionMutationCAT gene - C435G (nucleotide) - silent mutagenesi…PromoterAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTU2-b-RFP
Plasmid#72959PurposeLevel 2 Destination vector - Position B - Assembly of 3 TU's from Level 1-ABCDepositorInsertLevel 2 - b site
UseSynthetic BiologyTagsExpressionMutationCAT gene - C435G (nucleotide) - silent mutagenesi…PromoterAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
double_sgRNA targeting e3 and e7
Plasmid#190689PurposesgRNAs targeting enhancer 3 and 7 of MYC separatelyDepositorInsertsgRNAs targeting enhancer 3 and 7 of MYC separately
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianMutationPromoterAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Pdha1
Plasmid#175936Purposeknockout mouse Pdha1DepositorInsertPdha1 gRNA (Pdha1 Mouse)
UseRetroviralTagsExpressionMutationPromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIAeBlue
Plasmid#185891PurposeIn vivo gene amplification (HamAmp) of AeBlue expression module at RPL25 locusDepositorInsertPRPL25(Arm 1)> Kl.LEU2>TKl.LEU2- TRPL25(Arm 3)- ARS305- PALD6>AeBlue>TPGK1- PBTS1> RPL25(partial; Arm2)
UseTagsExpressionYeastMutationNonePromoterAvailable sinceSept. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIEforRed
Plasmid#185892PurposeIn vivo gene amplification (HamAmp) of EforRed expression module at RPL25 locusDepositorInsertPRPL25(Arm 1)> Kl.LEU2>TKl.LEU2- TRPL25(Arm 3)- ARS305- PALD6>EforRed>TPGK1-PBTS1> RPL25(partial; Arm2)
UseTagsExpressionYeastMutationNonePromoterAvailable sinceSept. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6_HEK3+1T>A_(PP7-C4-Q1)
Plasmid#232437PurposepegRNA with optimized 3' modifications to facilitate a +1 T to A prime edit in the HEK3 locusDepositorInsert3'-PP7-tagged pegRNA for rd12 correction driven by human U6 promoter
UseCRISPRTagsExpressionMutationPromoterU6Available sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ292 (AaCas12b)-D570A-TV-MS2-VPR
Plasmid#136382PurposeCRISPRa Gateway entry clone for catalytically dead AaCas12b (D570A) fused with TV activation system, followed by T2A and MCP-VPR fusion proteinDepositorInsertAaCas12b (D570A)-TV-T2A-MCP-VPR
UseCRISPRTagsExpressionPlantMutationD570APromoterAvailable sinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ292 (AaCas12b)-D570A-TV-MS2-TV
Plasmid#136381PurposeCRISPRa Gateway entry clone for catalytically dead AaCas12b (D570A) fused with TV activation system, followed by T2A and MCP-TV fusion proteinDepositorInsertAaCas12b (D570A)-TV-T2A-MCP-TV
UseCRISPRTagsExpressionPlantMutationD570APromoterAvailable sinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pCCL-PGK-SPdCas9-BFP-DNMT3B(E697A)
Plasmid#71214PurposedCas9 fused to BFP and the human DNMT3B catalytically inactive domainDepositorInsertdSpCas9-BFP-DNMT3B(E697A), DNMT3B catalytic domain with inactivation mutation E697A
UseTagsdSpCas9-BFP-DNMT3B(E697A)ExpressionMammalianMutationPromoterAvailable sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-SPdCas9-DNMT3B(E697A)-2A-Blast
Plasmid#71219PurposedCas9 fused to the human DNMT3B catalytically inactive domainDepositorInsertdSpCas9-DNMT3B(E697A), DNMT3B catalytic domain with inactivation mutation E697A
UseLentiviralTagsdSpCas9-DNMT3B(E697A)ExpressionMammalianMutationPromoterAvailable sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MCS-shCHD5 #1
Plasmid#68876PurposeCHD5 shRNA expressed from Adeno-associated viral (AAV) vectorDepositorInsertCHD5
UseAAV and RNAiTagsExpressionMammalianMutationPromoterH1Available sinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only