We narrowed to 5,962 results for: crispr cas9 expression plasmids
-
Plasmid#107304PurposeExpresses ZFP-VEGFA-TS3 fused to FRB in mammalian cellsDepositorInsertZFP_VEGFA-TS3
UseCRISPRTags2xNES, 3x Flag, 2xNLS, and FRBExpressionMammalianPromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYC1640
Plasmid#158719PurposeCRISPR system used for genome editing in Mycobacterium tuberculosis. Helper plasmid expresses Sth1 Cas9 and the cognate sgRNA, using zeocin as a selection marker.DepositorInsertSth1 sgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYC2085
Plasmid#158721PurposeCRISPR system used for genome editing in Mycobacterium tuberculosis. Helper plasmid expresses Sth1 Cas9 and the cognate sgRNA, using hygromycin as a selection marker.DepositorInsertSth1 sgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMLM3705
Plasmid#47754PurposeExpresses mammalian cell codon-optimized dCas9-VP64DepositorInsertcodon optimized dCas9-VP64
UseCRISPRTags3x FLAG, NLS, and VP64ExpressionMammalianMutationD10A and H840A mutations in Cas9 (catalytically i…PromoterCMVAvailable SinceAug. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Nat
Plasmid#232100PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
PU6::klp-12_sgRNA
Plasmid#46170Purposeklp-12 targeting sgRNADepositorInsertklp-12 targeting sgRNA (klp-12 Synthetic)
UseCRISPRExpressionWormPromoterC. elegans U6 snRNA pol III promoterAvailable SinceJuly 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1_Tet-inducible Luciferase reporter
Plasmid#64161PurposePhotoactivatable transcription system. Mammalian expression of sgRNA1 to target Tet-inducible-luciferase reporter.DepositorInsertsgRNA1 for Tet-inducible Luciferase reporter
UseCRISPRExpressionMammalianPromoterhuman U6Available SinceJune 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Kan
Plasmid#232102PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg
Plasmid#232101PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-SpG-P2A-EGFP (RTW4562)
Plasmid#140002PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with SpG(D10A/D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9 variant named SpG with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpG=D1135L/S1136W/G1218K/E1219Q/R13…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166
Plasmid#109328PurposeGateway entry plasmid (attL1 & attR5) expressing 3_FLAG-NLS-zCas9-NLS without promoterDepositorInsertzCas9
UseCRISPR; Gateway compatible zcas9 entry cloneTags3x FLAG, NLS and NLSExpressionPlantMutationZea mays codon-optimized Cas9Available SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSL1180-HR-Aag2-loxP-PUb-RFP-loxP-3xFLAG-AGO1
Plasmid#162164PurposeSelectable homology donor template for Aag2 cell AGO1DepositorInsertsRFP
3xFLAG
UseCRISPR and Cre/Lox; Homology donor templateTagsAGO1 homology and loxPExpressionInsectPromoterAe. aegypti PUb and endogenous AGO1Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP1
Plasmid#166103PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombination.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXPR_050
Plasmid#96925Purposelentiviral expression of gRNA scaffoldDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYC1446
Plasmid#158720PurposeIntegrating plasmid expressing Sth1 Cas9 and the cognate sgRNADepositorInsertSth1 sgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-mGreenLantern332
Plasmid#188483PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting mGreenLantern fluorescent protein site 332.DepositorInsertmGreenLantern sgRNA
UseCRISPRTagsPB_rtTA_BsmBIExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-CMV152
Plasmid#188485PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting cytomegaloviral promoter site 152.DepositorInsertCMV promoter sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-tdTomato166/892
Plasmid#188488PurposegRNA plasmid with neo resistance expressing a double cutting single gRNA targeting tdTomato fluorescent protein sites 166 & 892.DepositorInserttdTomato sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only