We narrowed to 3,422 results for: FRI;

#213246

The DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.

Thomas Sakmar

Dahl et al Sci Adv. 2023 May 3;9(18):eadf9297. doi:

April 30, 2024

Academic Institutions and Nonprofits only

#213245

The DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.

Thomas Sakmar

Dahl et al Sci Adv. 2023 May 3;9(18):eadf9297. doi:

April 30, 2024

Academic Institutions and Nonprofits only

#213244

The DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.

Thomas Sakmar

Dahl et al Sci Adv. 2023 May 3;9(18):eadf9297. doi:

April 30, 2024

Academic Institutions and Nonprofits only

#185658

Mitochondrial targetted (Cox8) FKBP protein with C-terminal HA epitope

Dipayan Chaudhuri

Balderas et al Nat Commun. 2022 May 19;13(1):2769. doi:

July 18, 2022

Academic Institutions and Nonprofits only

#132395

Targets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backbone

Gerold Schmitt-Ulms

Wang et al Bio Protoc. 2020 May 5;10(9):e3615. doi:

May 6, 2020

Academic Institutions and Nonprofits only

#118376

Gateway compatible donor vector with KAT14-547-782 truncation.

Maria Vartiainen

Viita et al J Cell Sci. 2019 Apr 17;132(8). pii: jcs

June 18, 2019

Academic Institutions and Nonprofits only

#123401

construction of TCR

Catherine Wu

Hu et al Blood. 2018 Nov 1;132(18):1911-1921. doi

May 7, 2019

Academic Institutions and Nonprofits only

#118377

Gateway compatible donor vector with KAT14-1-546 truncation.

Maria Vartiainen

Viita et al J Cell Sci. 2019 Apr 17;132(8). pii: jcs

Nov. 30, 2018

Academic Institutions and Nonprofits only