We narrowed to 7,149 results for: cas9 plasmid
-
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-CASANOVA
Plasmid#113036PurposeAAV vector for CASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 RFP670
Plasmid#187646Purposelentiviral vector expressing RFP670 alongside Cas9 and an sgRNA cloning siteDepositorInsertRFP 670
UseLentiviralTagsRFP670 and sgRNA cloning sitePromoterEFS (P2A)Available SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX458_SSRP1_1
Plasmid#72371PurposeEncodes gRNA for 3' target of human SSRP1 along with Cas9 with 2A GFPDepositorInsertSSRP1 (SSRP1 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_SSRP1_2
Plasmid#72372PurposeEncodes gRNA for 3' target of human SSRP1 along with Cas9 with 2A GFPDepositorInsertSSRP1 (SSRP1 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_PBX2_1
Plasmid#72357PurposeEncodes gRNA for 3' target of human PBX2 along with Cas9 with 2A GFPDepositorInsertPBX2 (PBX2 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_PBX2_2
Plasmid#72358PurposeEncodes gRNA for 3' target of human PBX2 along with Cas9 with 2A GFPDepositorInsertPBX2 (PBX2 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
DKC1 F1.3 gRNA
Plasmid#90652Purpose3rd generation lentiviral gRNA plasmid targeting human DKC1DepositorInsertDKC1 (Guide Designation F1.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
DKC1 F2.3 gRNA
Plasmid#90653Purpose3rd generation lentiviral gRNA plasmid targeting human DKC1DepositorInsertDKC1 (Guide Designation F2.3)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT1T2
Plasmid#50590PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT1, U626t plus, U629p, T2
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT2T3
Plasmid#50591PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT2, gRNA scaffold, U6-29t plus, U6-1p, T3
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
FOXM1 C11.2 gRNA
Plasmid#90690Purpose3rd generation lentiviral gRNA plasmid targeting human FOXM1DepositorInsertFOXM1 (Guide Designation C11.2)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT3T4
Plasmid#50592PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT3, gRNA scaffold, U6-1tplus, U6-26p, T4
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEasyG1_nat
Plasmid#184911PurposeTemplate to generate via PCR a single gRNA for expression in S. cerevisiaeDepositorInsertgRNA scaffold
UseCRISPRExpressionBacterial and YeastAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
BRCA1 A10.2 gRNA
Plasmid#90549Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA1DepositorInsertBRCA1 (Guide Designation A10.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
BRCA2 A11.2 gRNA
Plasmid#90550Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA2DepositorInsertBRCA2 (Guide Designation A11.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGxxFP-Cetn1
Plasmid#50717PurposeCetn1 genomic region was placed in pCAG-EGxxFP. Positive control for DSB mediated EGFP reconstitution.DepositorAvailable SinceFeb. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
BB44_pmc.DonorR5.TS
Plasmid#199223PurposeDonor plasmid with CCR5 target sites for ITPN or HMEJ knock-in at the human CCR5 safe harbour locusDepositorInsertExpression unit for mCherry - monomeric derivative of DsRed fluorescent protein (Shaner et al., 2004)
UseGene targeting donor plasmidExpressionMammalianPromoterHuman PGK1 gene promoterAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
NAE1 G8.3 gRNA
Plasmid#90777Purpose3rd generation lentiviral gRNA plasmid targeting human NAE1DepositorInsertNAE1 (Guide Designation G8.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only