5,013 results
-
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT1AR-7xsfGFP11-HA-HDR-donor
Plasmid#221832PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT1AR coding frameDepositorInsert7xGFP11-HA donor with 5-HT1AR homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2BR-7xsfGFP11-HA-HDR-donor
Plasmid#221833PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2BR coding frameDepositorInsert7xGFP11-HA donor with 5-HT2BR homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_2xFlag-dSERT-HDR-donor-HDR
Plasmid#221835PurposeDonor plasmid for inserting 2xFLAG at the beginning of Drosophila SERT coding frameDepositorInsert2xFLAG with dSERT homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT1BR-7xsfGFP11-HA-HDR-donor
Plasmid#221837PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT1BR coding frameDepositorInsert7xGFP11-HA donor with 5-HT1BR homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2AR(isoformD)-7xsfGFP11-HA-HDR-donor
Plasmid#221838PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsert7xGFP11-HA donor with 5-HT2AR (isoform D) homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2AR(isoformBFH)-7xsfGFP11-HA-HDR-donor
Plasmid#221839PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsert7xGFP11-HA donor with 5-HT2AR (isoforms BFH) homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-Myc-BirA*G3
Plasmid#240233PurposeExpression of Myc-BirA*-G3 under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertMyc-BirA*G3
ExpressionInsectPromoterMTAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-23012
Plasmid#109180PurposePlasmid for expression of proteins under the control of a minimal HSP70 promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneExpressionInsectPromoterminimal HSP70 promoterAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-23122
Plasmid#109181PurposePlasmid for expression of N-terminally 3xFLAG-tagged proteins under the control of a minimal HSP70 promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneTags3xFLAGExpressionInsectPromoterminimal HSP70 promoterAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacD-23003
Plasmid#109183PurposePlasmid donor for expression of proteins under the control of a minimal HSP70 promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneExpressionInsectPromoterminimal HSP70 promoterAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacD-23004
Plasmid#109184PurposePlasmid donor for expression of proteins under the control of a minimal HSP70 promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneExpressionInsectPromoterminimal HSP70 promoterAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacD-23005
Plasmid#109185PurposePlasmid donor for expression of proteins under the control of a minimal HSP70 promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneExpressionInsectPromoterminimal HSP70 promoterAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-21222-SNF5
Plasmid#109186PurposePlasmid for expression of C-terminally 3xFLAG-tagged SNF5 under the control of a polh promoter in baculovirus/insect cell systemsDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-21122
Plasmid#109174PurposePlasmid for expression of N-terminally 3xFLAG-tagged proteins under the control of a polh promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneTags3xFLAGExpressionInsectPromoterpolyhedrinAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-21222
Plasmid#109175PurposePlasmid for expression of C-terminally 3xFLAG-tagged proteins under the control of a polh promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneTags3xFLAGExpressionInsectPromoterpolyhedrinAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-21232
Plasmid#109177PurposePlasmid for expression of C-terminally CBP-3xFLAG-ProteinA-tagged proteins under the control of a polh promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneTagsCBP-3xFLAG-ProteinAExpressionInsectPromoterpolyhedrinAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-M1-BRG1-3xFLAG
Plasmid#109188PurposePlasmid for expression of C-terminally 3xFLAG-tagged BRG1 under the control of a p10 promoter in baculovirus/insect cell systemsDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-M1-BRG1-3xFLAG-BAF57
Plasmid#109189PurposePlasmid for expression of C-terminally 3xFLAG-tagged BRG1 and untagged BAF57 under the control of a p10 promoter in baculovirus/insect cell systemsDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-RBAP46/RBBP7
Plasmid#109210PurposeEncodes human full-length RBBP7 (aka RBAP46) to be expressed in a baculovirus/insect cell expression systemDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-SAP30
Plasmid#109212PurposeEncodes human full-length SAP30 to be expressed in a baculovirus/insect cell expression systemDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-21222-SIN3B-3xFLAG
Plasmid#109214PurposeEncodes human full-length SIN3B with a C-terminal 3xFLAG tag to be expressed in a baculovirus/insect cell expression systemDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-HDAC1
Plasmid#109209PurposeEncodes human full-length HDAC1 to be expressed in a baculovirus/insect cell expression systemDepositorInserthuman full-length HDAC1, sequence-optimized for insect cells (HDAC1 Human, Synthetic)
ExpressionInsectPromoterPolyhedrinAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-20XUAS-IVS-Syn21-Positron2-p10
Plasmid#239082PurposeGal4 activated transgene expression of positive-going voltage sensor under the hsp70 promoter in D. melanogasterDepositorInsertPositron2
ExpressionInsectMutationR78K N81D D92N W178FPromoterhsp70Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-JFRC59-13XLexAop2-IVS-Syn21-Positron2-p10
Plasmid#239081PurposeLexA activated transgene expression of positive-going voltage sensor under the hsp70 promoter in D. melanogasterDepositorInsertPositron2
ExpressionInsectMutationR78K N81D D92N W178FPromoterhsp70Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only