8,210 results
-
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL-mGold2s
Plasmid#231761PurposeExpression of mGold2s in yeast cellsDepositorInsertmGold2s
ExpressionYeastMutationmGold2s is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterpTDH(GAP promoter)Available SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-SoxN-A22-EGFP
Plasmid#181731PurposeGalactose inducible expression of SoxN-A22-EGFPDepositorInsertSoxN-A22-EGFP (SoxN Fly)
Tags3xFLAG-EGFPExpressionYeastMutationextended repeat of 22 Ala residues replacing nati…Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
P415 ymNeongreen
Plasmid#224110PurposeExpressing ymNeongreen in yeastDepositorInsertymNeongreen
ExpressionYeastAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mStayGold-Hyg
Plasmid#236486PurposePlasmid for deleting or C-terminally tagging endogenous genes with mStayGold and selection on Hyg.DepositorInsertmStayGold
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mStayGold-Nat
Plasmid#236485PurposePlasmid for deleting or C-terminally tagging endogenous genes with mStayGold and selection on Nat.DepositorInsertmStayGold
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAP-U2-1
Plasmid#236472PurposePlasmid for integration at the native URA3 locus with 3xmCherry and 3xGFP under control of the strong bidirectional SpH2A/B promoter.DepositorInsertspH2Ap-3xmCherry spH2Bp-3xGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAP-U2-3
Plasmid#236474PurposePlasmid for integration at the native URA3 locus with 3xmCherry under control of the ScACT1 promoter and 3xGFP under control of the ApACT1 promoter.DepositorInsertscACT1p-3xmCherry apACT1p-3xGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-3xFLAG-PolyS
Plasmid#181728PurposeGalactose inducible expression of 3xFLAG-PolySDepositorInsert3xFLAG-PolyS
Tags3xFLAGExpressionYeastAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-3xFLAG-PolyA
Plasmid#181726PurposeGalactose inducible expression of 3xFLAG-PolyADepositorInsert3xFLAG-PolyA
Tags3xFLAGExpressionYeastAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-3xFLAG-PolyL
Plasmid#181727PurposeGalactose inducible expression of 3xFLAG-PolyLDepositorInsert3xFLAG-PolyL
Tags3xFLAGExpressionYeastAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-3xFLAG-PolyC
Plasmid#181729PurposeGalactose inducible expression of 3xFLAG-PolyCDepositorInsert3xFLAG-PolyC
Tags3xFLAGExpressionYeastAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAP-U2-4
Plasmid#236475PurposePlasmid for integration at the native URA3 locus with 3xmCherry under control of the ScACT1 promoter and 3xGFP under control of the ApTUB1 promoter.DepositorInsertscACT1p-3xmCherry apTUB1p-3xGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAP-U2-2
Plasmid#236473PurposePlasmid for integration at the native URA3 locus with 3xmCherry under control of the SpH2B promoter and 3xGFP under control of the ScACT1 promoter.DepositorInsertspH2Bp-3xmCherry scACT1p-3xGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mStayGold-G418
Plasmid#236487PurposePlasmid for deleting or C-terminally tagging endogenous genes with mStayGold and selection on G418.DepositorInsertmStayGold
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mCherry-Nat
Plasmid#236488PurposePlasmid for deleting or C-terminally tagging endogenous genes with mCherry and selection on Nat.DepositorInsertmCherry
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-sfGFP-Hyg
Plasmid#236480PurposePlasmid for deleting or C-terminally tagging endogenous genes with sfGFP and selection on Hyg.DepositorInsertsfGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mCherry-G418
Plasmid#236490PurposePlasmid for deleting or C-terminally tagging endogenous genes with mCherry and selection on G418.DepositorInsertmCherry
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only