8,265 results
-
Plasmid#232979PurposeGalactose iduced expression of Gcn4 S/ArotoL in yeastDepositorInsertGcn4 S/ArotoL
TagsTEV cleavage siteExpressionYeastMutationS101L, S104L, F108L, Y110L, S117L, S136L, S144LPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 K5
Plasmid#232966PurposeGalactose iduced expression of Gcn4 K+ in yeastDepositorInsertGcn4 K+
TagsTEV cleavage siteExpressionYeastMutationD103K, D115K, D127K, D133K, E143KPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoED solvvol
Plasmid#232958PurposeGalactose iduced expression of Gcn4 LVtoED solvvol in yeastDepositorInsertGcn4 ILVtoED solvvol
TagsTEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 Swap3
Plasmid#232960PurposeGalactose iduced expression of Gcn4 k0.47 in yeastDepositorInsertGcn4 k0.47
TagsTEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 R2
Plasmid#232970PurposeGalactose iduced expression of Gcn4 R+ in yeastDepositorInsertGcn4 R+
TagsTEV cleavage siteExpressionYeastMutationK118R, K140RPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 E+
Plasmid#232963PurposeGalactose iduced expression of Gcn4 E+in yeastDepositorInsertGcn4 E+
TagsTEV cleavage siteExpressionYeastMutationD105E, D118E, D139EPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 W120A
Plasmid#232962PurposeGalactose iduced expression of Gcn4 W120A in yeastDepositorInsertGcn4 W120A
TagsTEV cleavage siteExpressionYeastMutationW120APromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 P+
Plasmid#232971PurposeGalactose iduced expression of Gcn4 Proline in yeastDepositorInsertGcn4 Proline
TagsTEV cleavage siteExpressionYeastMutationS122P, T131F, A141P, E143DPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 R3
Plasmid#232973PurposeGalactose iduced expression of Gcn4 R++ in yeastDepositorInsertGcn4 R++
TagsTEV cleavage siteExpressionYeastMutationD103R, D133R, K143RPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 Swap3GFP
Plasmid#233010PurposeGalactose iduced expression of Gcn4 k0.47GFP in yeastDepositorInsertGcn4 k0.47
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoED WHA
Plasmid#232995PurposeGalactose iduced expression of Gcn4 ILVtoED W+HAin yeastDepositorInsertGcn4 ILVtoED W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationN126W, I128E, V130E, V135E, L137D, I142DPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 9acidAHA
Plasmid#232997PurposeGalactose iduced expression of Gcn4 9acidAHA in yeastDepositorInsertGcn4 9acidA
Tags3xHA and TEV cleavage siteExpressionYeastMutationE109A, E111A, E114A, D115A, E119A, D125A, D127A, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_DBD
Plasmid#232985PurposeGalactose iduced expression of Gcn4 DBD in yeastDepositorInsertGcn4 DBD
TagsTEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 F124I
Plasmid#232964PurposeGalactose iduced expression of Gcn4 F124I in yeastDepositorInsertGcn4 F124I
TagsTEV cleavage siteExpressionYeastMutationF124IPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 9acidA
Plasmid#232967PurposeGalactose iduced expression of Gcn4 9acidA in yeastDepositorInsertGcn4 9acidA
TagsTEV cleavage siteExpressionYeastMutationE109A, E111A, E114A, D115A, E119A, D125A, D127A, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 E2K2
Plasmid#232968PurposeGalactose iduced expression of Gcn4 EK+ in yeastDepositorInsertGcn4 EK+
TagsTEV cleavage siteExpressionYeastMutationS104K, S117E, S136E, S144KPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 9acidAGFP
Plasmid#233009PurposeGalactose iduced expression of Gcn4 9acidAGFP in yeastDepositorInsertGcn4 9acidA
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationE109A, E111A, E114A, D115A, E119A, D125A, D127A, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
ppAG415Gal_Gcn4 L113A+
Plasmid#232972PurposeGalactose iduced expression of Gcn4 L113A in yeastDepositorInsertGcn4 L113A
TagsTEV cleavage siteExpressionYeastMutationL113A, E114Y, N126H, D127E, S136APromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 Aro3+GFP
Plasmid#233002PurposeGalactose iduced expression of Gcn4 Aro3+GFP in yeastDepositorInsertGcn4 Aro3+
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationD103Y, N112T, L113Y, S117F, K140RPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoED
Plasmid#232957PurposeGalactose iduced expression of Gcn4 ILVtoED in yeastDepositorInsertGcn4 ILVtoED
TagsTEV cleavage siteExpressionYeastMutationL123D, I128E, V130E, V135E, L137D, I142DPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 Swap3HA
Plasmid#232998PurposeGalactose iduced expression of Gcn4 k0.47HA in yeastDepositorInsertGcn4 k0.47
Tags3xHA and TEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 StoL
Plasmid#232981PurposeGalactose iduced expression of Gcn4 StoL in yeastDepositorInsertGcn4 StoL
TagsTEV cleavage siteExpressionYeastMutationS104L, S117L, S136L, S144LPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRGFP
Plasmid#233006PurposeGalactose iduced expression of Gcn4 SATtoG KtoRGFP in yeastDepositorInsertGcn4 SATtoG KtoR
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoED WGFP
Plasmid#233007PurposeGalactose iduced expression of Gcn4 LVtoED W+GFPin yeastDepositorInsertGcn4 ILVtoED W+
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationN126W, I128E, V130E, V135E, L137D, I142DPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 R3W
Plasmid#232975PurposeGalactose iduced expression of Gcn4 R++ W+ in yeastDepositorInsertGcn4 R++ W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationD103R, N126W, D133R, K143RPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 44mer
Plasmid#232956PurposeGalactose iduced expression of Gcn4 WT 44mer in yeastDepositorInsertGcn4 WT 44mer
TagsTEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 E3HA
Plasmid#232996PurposeGalactose iduced expression of Gcn4 E+HA in yeastDepositorInsertGcn4 E+
Tags3xHA and TEV cleavage siteExpressionYeastMutationD105E, D118E, D139EPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WW+
Plasmid#232984PurposeGalactose iduced expression of Gcn4 WW+ in yeastDepositorInsertGcn4 WW+
TagsTEV cleavage siteExpressionYeastMutationE109N, S117D, T121W, N126W, T132WPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 F108A+
Plasmid#232974PurposeGalactose iduced expression of Gcn4 F108A in yeastDepositorInsertGcn4 F108A
TagsTEV cleavage siteExpressionYeastMutationF108A, T121L, A141PPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 solvvol W
Plasmid#232977PurposeGalactose iduced expression of Gcn4 solvvol W+ in yeastDepositorInsertGcn4 solvvol W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_DBDGFP
Plasmid#232999PurposeGalactose iduced expression of Gcn4 DBDGFP in yeastDepositorInsertDBD
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoAS
Plasmid#232959PurposeGalactose iduced expression of Gcn4 ILVtoAS in yeastDepositorInsertGcn4 ILVtoAS
TagsTEV cleavage siteExpressionYeastMutationL123S, I128S, V130A, V135A, L137S, I142SPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 44merGFP
Plasmid#233000PurposeGalactose iduced expression of Gcn4 WT 44merGFP in yeastDepositorInsertGcn4 WT 44mer
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 30mer
Plasmid#232986PurposeGalactose iduced expression of Gcn4 WT 30mer in yeastDepositorInsertGcn4 WT 30mer
TagsTEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS424 Prp8 WT TRP1
Plasmid#234120PurposeThe N-terminus of Prp8 was restored thereby destroying the NheI site and correcting the ORFDepositorInsertPrp8
ExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-CUP1pr-NFAPoptim
Plasmid#221110PurposeFAP insert for N-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-CUP1pr-CFAPoptim
Plasmid#221111PurposeFAP insert for C-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-MFA-Igkappa-FAPoptim-STE3
Plasmid#221114PurposeFAP tagged STE3 (N-terminally tagged, optimized for yeast expression) under the Tef1 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-STE3pr-MFA-Igkappa-FAPoptim-STE3-deltaPEST
Plasmid#221118PurposeFAP tagged STE3-PEST mutant (delta413-470 - N-terminally tagged, optimized) under the Ste3 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3-deltaPEST
ExpressionYeastMutationSTE3 mutant that lacks the PEST domain in the C-t…PromoterSTE3Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-STE3pr-MFA-Igkappa-FAPoptim-STE3-K424R
Plasmid#221119PurposeFAP tagged STE3-K424R mutant (N-terminally tagged, optimized) under the Ste3 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3-K424R
ExpressionYeastMutationSTE3 mutantK424RPromoterSTE3Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-ANP1-FAPoptim
Plasmid#221120PurposeFAP-tagged marker for the cis-Golgi (FAP optimized for yeast expression)DepositorInsertANP1-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-ERG6-FAPoptim
Plasmid#221121PurposeFAP-tagged marker for lipid droplets (FAP optimized for yeast expression)DepositorInsertERG6-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-PMA1-FAPoptim
Plasmid#221122PurposeFAP-tagged marker for the plasma membrane (FAP optimized for yeast expression)DepositorInsertPMA1-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-RPA34-FAPoptim
Plasmid#221123PurposeFAP-tagged marker for the nucleus (FAP optimized for yeast expression)DepositorInsertRPA34-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-SEC7-FAPoptim
Plasmid#221124PurposeFAP-tagged marker for the trans-Golgi (FAP optimized for yeast expression)DepositorInsertSEC7-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-VPH1-FAPoptim
Plasmid#221125PurposeFAP-tagged marker for the vacuolar membrane (FAP optimized for yeast expression)DepositorInsertVPH1-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-NFAPoptim
Plasmid#221088PurposeFAP insert for N-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-CFAPoptim
Plasmid#221089PurposeFAP insert for C-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-NFAPorig
Plasmid#221091PurposeFAP insert for N-terminally tagging genes of interest (original FAP + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only