We narrowed to 121 results for: HBB
-
Plasmid#26639DepositorInsertHbb (hbb Borrelia burgdorferi)
ExpressionBacterialAvailable sinceOct. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorPublicationAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-1xms2-2x3’UTR
Plasmid#122946PurposeFor expressing SaCas9 mRNA with one copy of MS2 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-MS2-HBB 3' UTR
UseAAVExpressionMammalianAvailable sinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRE-Tight-BI-Gl NORM-LacZA-TER-LacZB
Plasmid#86194Purposebeta Globin NMD construct with and without PTC under Bi-directional TET on promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAUseTet onExpressionMammalianMutation39TER in beta Globin in MCS IIPromoterTet onAvailable sinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJP-HBB-nLuc
Plasmid#175431PurposeExpresses nLuc with 5' leader of human beta globin (HBB) in mammalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertnLUC plus 5' HBB leader
ExpressionMammalianPromoterCMVAvailable sinceOct. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mHbb-bh1_ gRNA_1-MS2-Puro
Plasmid#192681PurposeLentiviral expression of sgRNA targeting mHbb-bh1promoter to activate mouse Hbb-bh1 transcriptionDepositorInsertMouse Hbb-bh1 activating gRNA #1 (Hbb-bh1 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSA073 HBB_IVS2-Cas9-BFP
Plasmid#249134PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertHBB_IVS2-Cas9-TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
PonA-BI-Gl-WT-18xPP7-WT-24xMS2 (Switch)
Plasmid#189793PurposeExpress wild-type beta-globin genes bi-directionally under ponasteron A inducible promoter in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertbeta-globin (Hbb Mouse, Human)
ExpressionMammalianPromoterPonasterone A inducibleAvailable sinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA128 A2UCOE-HBB_IVS2-Cas9-BFP
Plasmid#249152PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 5' UTR and blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-HBB_IVS2-Cas9-TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUC57-HBB-nLuc
Plasmid#175432PurposeUsed to generate IVT RNA for translation extractsDepositorInsertHBB-nLuc
UseLuciferaseExpressionBacterialPromoterT7Available sinceOct. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD685 HBB_IVS2-EnAsCas12a-BFP
Plasmid#249158PurposeOverexpression of EnAsCas12a-BFP with HBB IVS2 intron in 5' UTR with blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertHBB_IVS2-EnAsCas12a-TagBFP (HBB Human, Synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA075 Cas9-BFP-HBB_IVS2
Plasmid#249136PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 3' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9-TagBFP-HBB_IVS2 (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA072 Cas9-HBB_IVS2-BFP
Plasmid#249133PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron after Cas9 coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9-HBB_IVS2-TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD687 A2UCOE-HBB_IVS2-EnAsCas12a-BFP
Plasmid#249160PurposeOverexpression of EnAsCas12a-BFP with HBB IVS2 intron in 5' UTR with blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-HBB_IVS2-EnAsCas12a-TagBFP (HBB Human, Synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA074 Cas9-BFP/HBB_IVS2/BFP
Plasmid#249135PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron within BFP coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9-TagBFP/HBB_IVS2/TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA076 Cas9/HBB_IVS2/Cas9-BFP
Plasmid#249137PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron within Cas9 coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9/HBB_IVS2/Cas9-TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-1xPP7-2x3'UTR
Plasmid#122947PurposeFor expressing SaCas9 mRNA with one copy of PP7 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-PP7-HBB 3' UTR
UseAAVExpressionMammalianAvailable sinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCR2.1_HBB_N
Plasmid#87847PurposepCR2.1-based plasmid holding a 309-bp fragment containing the exon-1-exon-2 splice border of normal human β-globin mRNADepositorInsertHomo sapiens hemoglobin subunit beta (HBB), Normal cDNA fragment (Exon1/2) (HBB Human)
ExpressionBacterialAvailable sinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPD292 PPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-BFP
Plasmid#249156PurposeOverexpression of PPH-T2A-dCas9-NFZ-P2A-BFP with HBB IVS2 intron in PPH coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertPPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-mTagBFP2 (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only