-
Plasmid#232409PurposeAAV production plasmid for HBB UTRs vector from Fig. 3 that mediates HDR at HBB locus using HBB sg7 gRNA. HBA gene includes HBA1 exons and introns; HBB UTRs flank HBA1 cassette.DepositorInsertHemoglobin Subunit Alpha 1 (HBA1 Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21a Hbb
Plasmid#26639DepositorInsertHbb (hbb Borrelia burgdorferi)
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
sgRNA HBB
Plasmid#128120PurposeCo-expresses sgRNA HBB, SpyCas9 scaffold (F+E) and GFP (transfection marker)DepositorInsertsgRNA HBB + GFP
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterRSV/U6Available sinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1_HBB_N
Plasmid#87847PurposepCR2.1-based plasmid holding a 309-bp fragment containing the exon-1-exon-2 splice border of normal human β-globin mRNADepositorInsertHomo sapiens hemoglobin subunit beta (HBB), Normal cDNA fragment (Exon1/2) (HBB Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1_HBB_A
Plasmid#87848PurposepCR2.1-based plasmid holding a 328-bp fragment containing the exon-1-exon-2 splice border of aberrant HBB[IVSI-110(G>A)] human β-globin mRNADepositorInsertHomo sapiens hemoglobin subunit beta (HBB), Aberrant cDNA fragment (Exon1/19nt mispliced Intron1 + Exon2) (HBB Human)
UseTagsExpressionBacterialMutationHBB(IVSI-110) β-thalassaemia misplicing mutation …PromoterAvailable sinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHBBAD113
Plasmid#121912PurposeCharge-Introduced NpuDnaBC39 inteinDepositorInsertCI-NpuDnaBC39 intein
UseTagsGB1-His6ExpressionBacterialMutationS110K, I111KPromoterParaAvailable sinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBBAD168
Plasmid#121916PurposeOth-NpuDnaBC39 inteinDepositorInsertOth-NpuDnaBC39 intein
UseTagsGB1-His6ExpressionBacterialMutationI111K, E116KPromoterParaAvailable sinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pL8N_RB610-HBB_X1
Plasmid#191521PurposeExpression of nuclear ZF-DdCBE in mammalian cells (N-terminal DddAC, Right)DepositorInsertZF-DdCBE RB610-HBB X1
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL5N_LT32-HBB_X1
Plasmid#191520PurposeExpression of nuclear ZF-DdCBE in mammalian cells (N-terminal DddAN, Left)DepositorInsertZF-DdCBE LT32-HBB X1
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC57-HBB-nLuc
Plasmid#175432PurposeUsed to generate IVT RNA for translation extractsDepositorInsertHBB-nLuc
UseLuciferaseTagsExpressionBacterialMutationPromoterT7Available sinceOct. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJP-HBB-nLuc
Plasmid#175431PurposeExpresses nLuc with 5' leader of human beta globin (HBB) in mammalian cells.DepositorInsertnLUC plus 5' HBB leader
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceOct. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
MKC84_HBB(HBA1reg-HBA1)
Plasmid#232410PurposeAAV production plasmid for HBA1 UTRs vector from Fig. 3 that mediates HDR at HBB locus using HBB sg7 gRNA. HBA gene includes HBA1 exons and introns; HBA1 UTRs flank HBA1 cassette.DepositorInsertHemoglobin Subunit Alpha 1 (HBA1 Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
KRD9_HBA1(HBA1reg-HBB)
Plasmid#232402PurposeAAV production plasmid for HBA1 UTRs vector from Fig. 3 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank HBA1 cassette. HAs are ~400bp each.DepositorInsertHemoglobin Subunit Alpha 1 (HBA1 Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
KRD22_HBA1(HBA1reg-HBB-longHAs)
Plasmid#232403PurposeAAV production plasmid for HBA1 long HAs vector from Figs. 3-6 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank full HBA1-2A-YFP cassette. HAs are ~900bpDepositorUseTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC62_HBB(HBA1reg-HBA1-2A-YFP)
Plasmid#232408PurposeAAV production plasmid for HBA1-2A-YFP vector from Fig. 2 that mediates HDR at HBB locus using HBB sg7 gRNA. HBA gene includes HBA1 exons and introns; HBA1 UTRs flank full HBA1-2A-YFP cassette.DepositorInsertHemoglobin Subunit Alpha 1 (HBA1 Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
NG0888 pCI-TPI-PTC48-HBB
Plasmid#65802PurposeNMD reporter mRNADepositorInsertTPI (TPI1 Human)
UseTagsHBB (beta-globin 3'UTR for probe binding)ExpressionMammalianMutationpremature stop codon at 48PromoterCMVAvailable sinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
MKC106_HBB(HBA1reg-HBA1-IRES-tEPOR)
Plasmid#232411PurposeAAV production plasmid for HBA+tEPOR vector from Figs. 4-6 that mediates HDR at HBB locus using HBB sg7 gRNA. HBA gene includes HBA1 exons and introns; HBA1 UTRs flank HBA+tEPOR cassette.DepositorInsertHemoglobin Subunit Alpha 1 (HBA1 Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mHbb-bh1_ gRNA_1-MS2-Puro
Plasmid#192681PurposeLentiviral expression of sgRNA targeting mHbb-bh1promoter to activate mouse Hbb-bh1 transcriptionDepositorInsertMouse Hbb-bh1 activating gRNA #1 (Hbb-bh1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (Hbb Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only