We narrowed to 874 results for: PX330
-
Plasmid#110815PurposeUsed with pNTK Gatad2a flox allele targeting construct in mouse cellsDepositorInsertmGataD2a (Gatad2a Mouse)
ExpressionMammalianAvailable SinceDec. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110)
Plasmid#71707PurposeA human codon-optimized SpCas9 fused to first 110 amino acids of human GEMININ and chimeric guide RNA expression plasmidDepositorInserthumanized S. pyogenes Cas9 fused to human Geminin (GMNN Human)
UseCRISPRTags3xFLAG and hGEM(1/110)ExpressionMammalianPromoterCBhAvailable SinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-SpCas9-HF1 (without sgRNA)
Plasmid#92102PurposeExpression plasmid for human codon-optimized high-fidelity SpCas9-HF1, px330-like backbone (without U6-sgRNA coding sequence)DepositorInsert3xFlag-NLS-Streptococcus pyogenes Cas9-HF1-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDY156: SUZ12 px330 sgRNA Cas9 plasmid
Plasmid#170792PurposeThis plasmid encodes Cas9 and a sgRNA that targets the SUZ12 locus; to be used with pDY153DepositorInsertCas9
ExpressionMammalianAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-HEK3-CTTins-px330-scaffold
Plasmid#180017PurposeTransiently expressing a pegRNA to introduce HEK3 CTT insertion in human cells. It has a sgRNA scaffold from px330.DepositorInsertPrime editing pegRNA for HEK3-CTTins, with px330 scaffold (EPHA8 Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-(negative selection module)-Chimeric_BB-CBh-hSpCas9
Plasmid#223321PurposeIt contains a ccdB-CMr negative selection module flanked by BpiI (BbsI) sites that allows excluding clones without correct insertion of sgRNA. Human codon optimized Cas9 expressing plasmid.DepositorInsertsUseCRISPR and Synthetic BiologyExpressionMammalianPromoterCBhAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-evoSpCas9 (without sgRNA; with silent mutations)
Plasmid#126758PurposeExpression plasmid for human codon-optimized increased fidelity evoSpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertevoSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationM495V, Y515N, K526E, R661QPromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-HeFSpCas9 (without sgRNA; with silent mutations)
Plasmid#126759PurposeExpression plasmid for human codon-optimized increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertHeFSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, K1003A, R1060APromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-WT_SpCas9 (without sgRNA; with silent mutations)
Plasmid#126753PurposeExpression plasmid for human codon-optimized WT SpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertWT SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianPromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-eSpCas9 (without sgRNA; with silent mutations)
Plasmid#126754PurposeExpression plasmid for human codon-optimized increased fidelity eSpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInserteSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationK848A, K1003A, R1060APromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-HypaSpCas9 (without sgRNA; with silent mutations)
Plasmid#126756PurposeExpression plasmid for human codon-optimized increased fidelity HypaSpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertHypaSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN692A, M694A, Q695A, H698APromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-HiFi SpCas9 (without sgRNA; with silent mutations)
Plasmid#126778PurposeExpression plasmid for human codon-optimized increased fidelity HiFi SpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertHiFi SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationR691APromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-Sniper SpCas9 (without sgRNA; with silent mutations)
Plasmid#126777PurposeExpression plasmid for human codon-optimized increased fidelity Sniper SpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertSniper SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationF539S, M763I, K890NPromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-SpCas9-HF1 (without sgRNA; with silent mutations)
Plasmid#126755PurposeExpression plasmid for human codon-optimized increased fidelity SpCas9-HF1 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertSpCas9-HF1
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926APromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYFP-NEAT1pr_v1-RT
Plasmid#97087PurposeEncodes a HR repair template for knock-in a YFP expression cassette at the promoter of human NEAT1 gene. Best used with px330-NEAT1pr_v1 vector, but also works with px330-NEAT1pr_v2.DepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
ATG16L1 sgRNA
Plasmid#207563PurposepX330 expressing Cas9 and a sgRNA targeting the ATG16L1 locusDepositorInsertGCAGCAAGTGACATGTCGTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
LC3B sgRNA
Plasmid#207556PurposepX330 expressing Cas9 and a sgRNA targeting the LC3B locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
ULK1 sgRNA
Plasmid#207559PurposepX330 expressing Cas9 and a sgRNA targeting the ULK1 locusDepositorInsertCCAGCCAGGCCAGAAAGGTC
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG9A sgRNA
Plasmid#207557PurposepX330 expressing Cas9 and a sgRNA targeting the ATG9A locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
WIPI2 sgRNA
Plasmid#207554PurposepX330 expressing Cas9 and a sgRNA targeting the WIPI2 locusDepositorInsertCGCGCGCCCAGCCATGAACC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG5 sgRNA
Plasmid#207555PurposepX330 expressing Cas9 and a sgRNA targeting the ATG5 locusDepositorInsertAACTTGTTTCACGCTATATC
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
ULK1 KO sgRNA
Plasmid#207561PurposepX330 expressing Cas9 and a sgRNA targeting the ULK1 locusDepositorInsertCCCGCCTGCGCCATGGAGCC
ExpressionMammalianPromoterCMV and U6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG13 sgRNA
Plasmid#207558PurposepX330 expressing Cas9 and a sgRNA targeting the ATG13 locusDepositorInsertggaaactgatctcaattccc
ExpressionMammalianPromoterCMV and U6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only