We narrowed to 23,111 results for: promoter
-
Plasmid#153389PurposeConfers resistance to kanamycin and G418DepositorInsertNptII
UseTagsExpressionPlantMutationPromoterAvailable sinceOct. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
HIP-flash (HOP-flash mutant)
Plasmid#83466PurposeNegative control for HOP-flash. 7xmut TEAD binding sites with minimal promoter plus luciferase reporter geneDepositorInsertMultimerized mutated TEAD binding sites in the promoter of CTGF with minimal promoter (CCN2 Human)
UseLuciferaseTagsExpressionMutationPromoterAvailable sinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SPDK3876(TRV-RNA2-pPEBV-MCS)
Plasmid#149275PurposeModified Tobacco rattle virus RNA2 vector that could be used for expression of proteins or RNAsDepositorInsertModified TRV RNA2 with PEBV promoter
UseT-dna vectorTagsExpressionMutationT2318C (DNA) in PEBV coat protein sequencePromoterAvailable sinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
Il12b 400bp pro-Luc
Plasmid#20020DepositorInsertIl12b promoter (Il12b Mouse)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGL3-NBRE3
Plasmid#208254PurposepGL3 promoter luciferase reporter vector containing 3 copies of the NBRE DNA response element (5′-GAGTTTTAAAAGGTCATGCTCAATT TGTC-3′) used for luciferase reporter assays in mammalian cellsDepositorInsert3X NBRE-LUC
UseTagsExpressionMammalianMutationPromoterSV40 early promoterAvailable sinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P41nmt1-GFP
Plasmid#39290DepositorInsertnmt1 promoter (nmt1 Fission Yeast)
UseYeast genomic targetingTagsA. gossypii translation elongation factor 1a gene…ExpressionMutation-1163 to +6 of nmt1 locus with a 4bp deletion (TA…PromoterAvailable sinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P81nmt1-GFP
Plasmid#39291DepositorInsertnmt1 promoter (nmt1 Fission Yeast)
UseYeast genomic targetingTagsA. gossypii translation elongation factor 1a gene…ExpressionMutation-1163 to +6 of nmt1 locus with a 7bp deletion (AT…PromoterAvailable sinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMV306DIhsp+LuxG13
Plasmid#49999PurposeIntegrase removed to increase stability of the plasmid in mycobacteriaDepositorInsertBacterial luciferase operon + G13 promoter
UseTagsExpressionBacterialMutationIt contains a gram-positive enhanced translation …PromoterG13 from M. marinum G13 promoter driving luxCAvailable sinceMay 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hADM-RFP
Plasmid#22922DepositorInserthuman adrenomedullin promoter driving DsRedExpress (ADM Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pNW538_pAAVS1-pAP1(2)-FlpO-ABI-P2A-PYL-FlpO-CAG-U1-frt-STOP-frt-U2-GFP-P2A-luc2-ZeoR
Plasmid#192939PurposeFlpO-based digitizer circuit driven by AP1 promoterDepositorInsertsAP1(2)/minTK promoter
FlpO-ABI
PYL-FlpO
CAG promoter
frt-STOP-frt
GFP
luciferase
pPGK
Zeocin resistance
BFP
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRR-AR
Plasmid#73045PurposeConstitutively expresses the androgen receptor, which is required for the activation of the promoter in pLAREG (Addgene plasmid #73045)DepositorInsertAndrogen receptor (AR Human)
UseTagsExpressionYeastMutationplease see depositor comments belowPromoterglyceraldehyde phosphate dehydrogenase (GPD)Available sinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
p8327 pLIX YAP1 S127A
Plasmid#184528PurposeExpression of YAP1 S127ADepositorInsertYAP1 S127A (YAP1 Human)
UseLentiviralTagsExpressionMutationS127APromoterTRE promoter, Tet ONAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
p8328 pLIX YAP1 S94A
Plasmid#184529PurposeExpression of YAP1 S94ADepositorInsertYAP1 S94A (YAP1 Human)
UseLentiviralTagsExpressionMutationS94APromoterTRE promoter, Tet ONAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
LV-Let7d-5p
Plasmid#117055PurposeOverexpression of Let-7d-5p using miR-451 backbone to enable DICER independent expression along with orange fluorescent protein (OFP) to track miRNA expressionDepositorInsertLet-7d-5p - OFP
UseLentiviralTagsExpressionMutationPromoterSFFV promoterAvailable sinceOct. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGfa2-nLac
Plasmid#53126PurposeExpression of LacZ driven by the human Gfa2 promoter. LacZ can also be replaced with the gene of interest for targeting transgene expression to astrocytes in mice.DepositorInsertGfa2 (GFAP Human)
UseMouse TargetingTagsLacZ, NLS, and mP1ExpressionMammalianMutationcontains -2163 to +47 (the human gfa2 segment), w…Promoterhuman GFAPAvailable sinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKIIa_SERT_EYFP
Plasmid#198737PurposeSerotonin transporter with EYFP fluorescent protein driven by CaMKIIa promoter on a AAV vectorDepositorInsertSerotonin transporter and yellow fluorescent protein
UseAAVTagsExpressionMammalianMutationPromoterCaMKIIaAvailable sinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P41nmt-3HA
Plasmid#39284DepositorInsertnmt1 promoter (nmt1 Fission Yeast)
UseYeast genomic targetingTags3xHA, A. gossypii translation elongation factor 1…ExpressionMutation-1163 to +6 of nmt1 locus with a 4bp deletion (TA…PromoterAvailable sinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P81nmt1-3HA
Plasmid#39285DepositorInsertnmt1 promoter (nmt1 Fission Yeast)
UseYeast genomic targetingTags3xHA, A. gossypii translation elongation factor 1…ExpressionMutation-1163 to +6 of nmt1 locus with a 7bp deletion (AT…PromoterAvailable sinceAug. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKM50
Plasmid#123656PurposeEncodes Renilla luciferase under the Aedes aegypti ubiquitin UbL40 promoter for constitutive expression in mosquito cellsDepositorInsertAedes aegypti UbL40 promoter
UseLuciferaseTagsExpressionInsectMutationPromoterUbL40 promoterAvailable sinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only