We narrowed to 18,987 results for: gateway
-
Plasmid#192727PurposeGateway entry vector encoding zebrafish sh3bgrDepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pDONR221-dyrk1ab
Plasmid#192726PurposeGateway entry vector encoding zebrafish dyrk1abDepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj6
Plasmid#192725PurposeGateway entry vector encoding zebrafish kcnj6DepositorInsertkcnj6 (kcnj6 Zebrafish)
UseGateway CloningMutation5' insertion of ATGGCCAAGCTGACAGAATCC, ident…PromoterNoneAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ets2
Plasmid#192724PurposeGateway entry vector encoding zebrafish ets2DepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-psmg1
Plasmid#192723PurposeGateway entry vector encoding zebrafish psmg1DepositorInsertpsmg1 (psmg1 Zebrafish)
UseGateway CloningMutationR96Q (rs514814252); T152M (rs501951686); T189A (r…PromoterNoneAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-get1
Plasmid#192722PurposeGateway entry vector encoding zebrafish get1DepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HMGN1-SE
Plasmid#192720PurposeGateway entry vector encoding mutant HMGN1DepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-B3GALT5
Plasmid#192719PurposeGateway entry vector encoding human B3GALT5DepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-hmgn6
Plasmid#192715PurposeGateway entry vector encoding zebrafish hmgn6DepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTpPBR11_fcpNAT_GWB
Plasmid#154032PurposeGateway cloning into T. pseudonana episomal vectorDepositorTypeEmpty backboneUseDiatom cloningAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
R777-E350 Hs.TIAM2-nostop
Plasmid#70634PurposeGateway ORF clone of human TIAM2 [NM_001010927.2] without stop codon (for C-terminal fusions)DepositorInsertTIAM2 (TIAM2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E326 Hs.SPRED3-nostop
Plasmid#70610PurposeGateway ORF clone of human SPRED3 [NM_001042522.2] without stop codon (for C-terminal fusions)DepositorInsertSPRED3 (SPRED3 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E336 Hs.STK11-nostop
Plasmid#70620PurposeGateway ORF clone of human STK11 [NM_000455.4] without stop codon (for C-terminal fusions)DepositorInsertSTK11 (STK11 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E337 Hs.STK3
Plasmid#70621PurposeGateway ORF clone of human STK3 [NM_006281.3] with stop codon (for native or N-terminal fusions)DepositorInsertSTK3 (STK3 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E338 Hs.STK3-nostop
Plasmid#70622PurposeGateway ORF clone of human STK3 [NM_006281.3] without stop codon (for C-terminal fusions)DepositorInsertSTK3 (STK3 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E339 Hs.STK4
Plasmid#70623PurposeGateway ORF clone of human STK4 [NM_006282.2] with stop codon (for native or N-terminal fusions)DepositorInsertSTK4 (STK4 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E344 Hs.TFDP1-nostop
Plasmid#70628PurposeGateway ORF clone of human TFDP1 [NM_007111.4] without stop codon (for C-terminal fusions)DepositorInsertTFDP1 (TFDP1 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E345 Hs.TFDP2
Plasmid#70629PurposeGateway ORF clone of human TFDP2 [NM_006286.4] with stop codon (for native or N-terminal fusions)DepositorInsertTFDP2 (TFDP2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E346 Hs.TFDP2-nostop
Plasmid#70630PurposeGateway ORF clone of human TFDP2 [NM_006286.4] without stop codon (for C-terminal fusions)DepositorInsertTFDP2 (TFDP2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E300 Hs.RPS6KB2-nostop
Plasmid#70584PurposeGateway ORF clone of human RPS6KB2 [NM_003952.2] without stop codon (for C-terminal fusions)DepositorInsertRPS6KB2 (RPS6KB2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E308 Hs.SHC1-nostop
Plasmid#70592PurposeGateway ORF clone of human SHC1 [NM_003029.4] without stop codon (for C-terminal fusions)DepositorInsertSHC1 (SHC1 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E314 Hs.SHC4-nostop
Plasmid#70598PurposeGateway ORF clone of human SHC4 [NM_203349.3] without stop codon (for C-terminal fusions)DepositorInsertSHC4 (SHC4 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E270 Hs.RASSF9-nostop
Plasmid#70554PurposeGateway ORF clone of human RASSF9 [NM_005447.3] without stop codon (for C-terminal fusions)DepositorInsertRASSF9 (RASSF9 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E276 Hs.RHEB-nostop
Plasmid#70560PurposeGateway ORF clone of human RHEB [NM_005614.3] without stop codon (for C-terminal fusions)DepositorInsertRHEB (RHEB Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E278 Hs.RHOA-nostop
Plasmid#70562PurposeGateway ORF clone of human RHOA [NM_001664.2] without stop codon (for C-terminal fusions)DepositorInsertRHOA (RHOA Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E280 Hs.RHOB-nostop
Plasmid#70564PurposeGateway ORF clone of human RHOB [NM_004040.3] without stop codon (for C-terminal fusions)DepositorInsertRHOB (RHOB Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E282 Hs.RHOC-nostop
Plasmid#70566PurposeGateway ORF clone of human RHOC [NM_175744.4] without stop codon (for C-terminal fusions)DepositorInsertRHOC (RHOC Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E240 Hs.RASGRF1-nostop
Plasmid#70524PurposeGateway ORF clone of human RASGRF1 [NM_001145648.1] without stop codon (for C-terminal fusions)DepositorInsertRASGRF1 (RASGRF1 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E242 Hs.RASGRF2-nostop
Plasmid#70526PurposeGateway ORF clone of human RASGRF2 [NM_006909.2] without stop codon (for C-terminal fusions)DepositorInsertRASGRF2 (RASGRF2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E258 Hs.RASSF3-nostop
Plasmid#70542PurposeGateway ORF clone of human RASSF3 [NM_178169.3] without stop codon (for C-terminal fusions)DepositorInsertRASSF3 (RASSF3 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E260 Hs.RASSF4-nostop
Plasmid#70544PurposeGateway ORF clone of human RASSF4 [NM_032023.3] without stop codon (for C-terminal fusions)DepositorInsertRASSF4 (RASSF4 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E208 Hs.RAC1-nostop
Plasmid#70492PurposeGateway ORF clone of human RAC1 [NM_006908.4] without stop codon (for C-terminal fusions)DepositorInsertRAC1 (RAC1 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E210 Hs.RAC2-nostop
Plasmid#70494PurposeGateway ORF clone of human RAC2 [NM_002872.4] without stop codon (for C-terminal fusions)DepositorInsertRAC2 (RAC2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E216 Hs.RALA-nostop
Plasmid#70500PurposeGateway ORF clone of human RALA [NM_005402.3] without stop codon (for C-terminal fusions)DepositorInsertRALA (RALA Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E218 Hs.RALB-nostop
Plasmid#70502PurposeGateway ORF clone of human RALB [NM_002881.2] without stop codon (for C-terminal fusions)DepositorInsertRALB (RALB Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E184 Hs.PIN1-nostop
Plasmid#70468PurposeGateway ORF clone of human PIN1 [NM_006221.3] without stop codon (for C-terminal fusions)DepositorInsertPIN1 (PIN1 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E192 Hs.PRKAA1-nostop
Plasmid#70476PurposeGateway ORF clone of human PRKAA1 [NM_006251.5] without stop codon (for C-terminal fusions)DepositorInsertPRKAA1 (PRKAA1 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E194 Hs.PRKAA2-nostop
Plasmid#70478PurposeGateway ORF clone of human PRKAA2 [NM_006252.3] without stop codon (for C-terminal fusions)DepositorInsertPRKAA2 (PRKAA2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E150 Hs.PAK2-nostop
Plasmid#70434PurposeGateway ORF clone of human PAK2 [NM_002577.4] without stop codon (for C-terminal fusions)DepositorInsertPAK2 (PAK2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only