We narrowed to 17,774 results for: URE
-
Plasmid#91434PurposeProtein expression and purification of human SH3 domain construct SASH3-1/1DepositorInsertSASH3-1/1 (SASH3 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-CDS
Plasmid#136045PurposeUPF3B shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GAAGCCTTGTTCCGATCTAAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAcrF1
Plasmid#89233PurposePlasmid contains the gene for anti-CRISPR protein AcrF1 (gene 35 from bacteriophage JBD30), with N-terminal 6his tag and TEV protease cleavage siteDepositorInsertAcrF1
Tags6xHis-TEV and FLAGAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
ath5:H2B-RFP
Plasmid#105960Purposetransgenesis, appears rather late, likely due to long RFP maturation time but is brighter than most other Ath5 constructDepositorAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjFOXL2-coemiRFP670-PGK-Puro
Plasmid#186168PurposeKnock-in gene targeting in marmoset cells at FOXL2 locusDepositorInsertemiRFP670
UseMarmoset targetingMutationhuman codon-optimizedAvailable SinceNov. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter hsa-mir-128-1
Plasmid#46675DepositorInserthsa-mir-128-1 (MIR128-1 Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianPromoterCMVAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
PHKG2_HUMAN_D0
Plasmid#79736PurposeThis plasmid encodes the kinase domain of PHKG2. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
VRK2_HUMAN_D0
Plasmid#79737PurposeThis plasmid encodes the kinase domain of VRK2. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-V5-SBP-C1-Hs4EBP3_Z
Plasmid#148151PurposeMammalian Expression of Hs4EBP3DepositorInsertHs4EBP3 (EIF4EBP3 Human)
ExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL0721 (pDonor_L1-105)
Plasmid#130645PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene and shortened left end. Total transposon size = 933 bp.DepositorInsertVchCAST donor DNA (short L)
UseCRISPR; TransposonExpressionBacterialAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only