We narrowed to 1,691 results for: CAG promoter
-
Plasmid#209191PurposeCloning of sgRNAs for expression in plantsDepositorInsertMtU6-26 SnRNA promoter
UseCloning vectorAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-tracrRNA-PMtU6-1
Plasmid#209190PurposeCloning of sgRNAs for expression in plantsDepositorInsertMtU6-1 SnRNA promoter
UseCloning vectorAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(sgCXCR1-2)-PGKpuro2ABFP-W
Plasmid#252916PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(sgCXCR1-1)-PGKpuro2ABFP-W
Plasmid#252915PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2-U3
Plasmid#173156PurposeSingle guide RNA cassette under U3 promoterDepositorInsertsgRNA cassette under U3 promoter
ExpressionPlantPromoterpromoter region of the U3C snRNA gene (Marshallsa…Available SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmIL-6 mut C/EBP
Plasmid#61291Purposedrives luciferase from mouse IL-6 promoter with mutant C/EBP (NF-IL-6) siteDepositorInsertIL-6 promoter (Il6 Mouse)
UseLuciferaseExpressionMammalianMutationMutated C/EBP binding site from ACATTGTGCAATCT to…PromoterIL-6 promoter with mutant C/EBP binding siteAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
WPXL SOX10 gRNA
Plasmid#101923PurposeSOX10 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertSOX10 promoter targeting gRNA
UseLentiviralAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(sgCXCR2-2)-PGKpuro2ABFP-W
Plasmid#252918PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
WPXL LEFTY2 gRNA
Plasmid#101924PurposeLEFTY2 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertLEFTY2 enhancer targeting gRNA
UseLentiviralAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only