We narrowed to 14,223 results for: Cas9
-
Plasmid#110862PurposeLentiviral vector for constitutive expression of Cas9-VRER-P2A-GFP (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIF1079
Plasmid#237445PurposeExpression SpCas9 and Efe1-RT from bidirectional CAG promoters. SpCas9 sgRNA and Efe1 non-coding expression is driven by U6 and H1 respecitvely.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsSpCas9
Efe1-RT
EMX1 sgRNA
Efe1-ncRNA targeting EMX1
Tags3xFLAGExpressionMammalianPromoterCAG, H1, and U6Available sinceJune 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTE_21 - pIVT_CMV-synUTR-inactT7-NLS-Cas9-NLS-XTEN-BLM(1-193)-NLS-HbaUTR
Plasmid#252017PurposeIn vitro transcription of Cas9-BLM(2-194) TruEditor for mRNA generationDepositorPublicationInsertCas9-BLM(2-194)
UseCRISPRExpressionMammalianMutationNAAvailable sinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pICSL90016
Plasmid#117514PurposeCas9_2 Golden Gate Level 0DepositorInsertBsaI:AATG:Cas9_2:GCTT:BsaI
UseCRISPRTagsNLS_SV40ExpressionPlantAvailable sinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 intron
Plasmid#176224PurposeA vector for the CRISPR-Cas9 system targeting an intron of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 exon
Plasmid#176033PurposeA vector for the CRISPR-Cas9 system targeting an exon of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV8-cPE-N
Plasmid#183538PurposeDeliver a split compact Prime Editor in vivoDepositorInsertN-terminal fragment of SpCas9 nickase (H840A)
UseAAVExpressionMammalianAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRGE31
Plasmid#50929PurposeExpressing sgRNA and Cas9 in plants. The sgRNA was controlled by rice snoRNA U3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRice snoRNA U3 and dual 35S promoterAvailable sinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-CBE6c-V106W
Plasmid#215826PurposeExpress CBE6c V106W (with SpCas9) in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCBE6c V106W-SpCas9-2xUGI (cas9 )
UseIn vitro transcription templateAvailable sinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTK0_046
Plasmid#123976PurposeEncodes the Cas9 Thal5.10-2_hg18 homology destination with Hygromycin resistance cassette GFP dropout destination vector as a type 0 part to be used in the MTK systemhDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthThal5.10-2_hg18 CAS9 Destination - HygroR
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCjedCas9
Plasmid#172216PurposeExpresses catalytically inactive Campylobacter jejuni Cas9 (CjedCas9) in bacterial cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertcatalytic mutant of Cas9 endonuclease from the Campylobacter jejuni Type II CRISPR/Cas system
TagsHistagMutationchanged Asp 8 to Ala and His 559 to AlaAvailable sinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pK237.U6-Chimeric-CAG-loxP-stop-loxP-hspCas9 (Supernova)
Plasmid#85041PurposeThis plasmid should be used for Cre/loxP-based Supernova-CRISPR/Cas9.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertloxP-stop-loxP
UseCRISPRExpressionMammalianAvailable sinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_3
Plasmid#155083PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-CBE6d-V106W
Plasmid#215827PurposeExpress CBE6d V106W (with SpCas9) in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCBE6d V106W-SpCas9-2xUGI (cas9 )
UseIn vitro transcription templateAvailable sinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAWP78-PVCpnf_pvc13-Ad5_pvc10-Cas9
Plasmid#243733PurposePVC structural operon - tail fiber (Pvc13) retargeted with Ad5 knob - spike tip (Pvc10) loaded with Cas9 on CTDDepositorInsertpvc13-Ad5_pvc10-Cas9
ExpressionBacterialAvailable sinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDe_Cas9_KANA_R160a
Plasmid#173756PurposeBinary expression vector with A.th. codon-optimized Cas9 and sgRNA for miRNA160aDepositorInsertCas9_sgRNA1/R160a_sgRNA2/R160a
UseCRISPRPromoterAtU6 &StU6Available sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDe_Cas9_KANA_R160b
Plasmid#173757PurposeBinary expression vector with A.th. codon-optimized Cas9 and sgRNA for miRNA160bDepositorInsertCas9_sgRNA1/R160b_sgRNA2/160b
UseCRISPRPromoterAtU6 &StU6Available sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only