We narrowed to 14,813 results for: mal.3
-
Plasmid#136052PurposeREG1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (ATTGTATCTCTGTAGTTTAAG)DepositorAvailable SinceMay 13, 2020AvailabilityAcademic Institutions and Nonprofits only
-
5xtetO HoxC 3'
Plasmid#131340PurposegRNA to insert 5xTet operator sequence into downstream of HoxC cluster.DepositorInsertHoxC-downstream-gRNA
UseCRISPRExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-3'UTR
Plasmid#136042PurposeUPF3A shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GACGTAGAAACACGCAGAAAC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-3
Plasmid#133403Purposehuman ETV6 gRNA-3 is a 20-nt gRNA expression plasmid targeting the second ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-EF1α-Luc-C20orf24-3’UTR-VAR
Plasmid#128507PurposeLentiviral constitutive expression of Firefly luciferase under control of 3'UTR of human C20orf24 with variant from COX deficiency patient.DepositorInsertFirefly luciferase
UseLentiviral and LuciferaseExpressionMammalianAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-C20orf24- C20orf24-3’UTR-VAR
Plasmid#128509PurposeLentiviral constitutive expression of C20orf24 under control of its native 3'UTR of human C20orf24 with variant from COX deficiency patient.DepositorAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXs_FLAG-Sfxn1-3 (CG11739)
Plasmid#110642PurposeRetroviral expression of Flag-tagged Drosophila CG11739 in mammalian cellsDepositorInsertCG11739 (CG11739 Fly)
UseRetroviralTagsFLAGExpressionMammalianMutationcodon-optimized cDNA (no amino acid mutations)Available SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
PAK4-FL-3'UTR-MT2
Plasmid#113093PurposeLuciferase reporter containing PAK4-FL- 3' UTR with the second predicted MiR-199a-3p binding site mutatedDepositorInsertp21 Activated kinase 4 (PAK4 Human)
UseLuciferaseExpressionMammalianMutationSecond predicted miR-199a-3p binding site mutated…PromoterPGKAvailable SinceAug. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
PAK4-FL-3'UTR-MT-both
Plasmid#113094PurposeLuciferase reporter containing PAK4-FL- 3' UTR with both the predicted MiR-199a-3p binding sites mutatedDepositorInsertp21 Activated kinase 4 (PAK4 Human)
UseLuciferaseExpressionMammalianMutationBoth the predicted miR-199a-3p binding site muta…PromoterPGKAvailable SinceAug. 17, 2018AvailabilityAcademic Institutions and Nonprofits only