We narrowed to 4,360 results for: 256
-
Plasmid#231361PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from the minBG promoter with mscRE4 enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.minBG-EGFP-W3SL_BbsI(GGA)
Plasmid#231362PurposeminBG-driven EGFP, containing cassette for BbsI-based Golden Gate assembly (e.g. of sgRNA cassette(s)). Can be used as 'no guide' control.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Ple155-CI-EGFP-W3SL_BbsI(GGA)
Plasmid#231363PurposePle155-driven EGFP, containing cassette for BbsI-based Golden Gate assembly (e.g. of sgRNA cassette(s)). Can be used as 'no guide' control.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6-sasgRNA(SapI)_Ple155-CI-EGFP-W3SL_BbsI(GGA)
Plasmid#231367PurposePle155-driven EGFP, also encoding U6-driven sgRNA cassette, with SapI sites to clone crRNA sequenceDepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6-sasgRNA(SapI)_Ple155-CI-mRuby2-W3SL_BbsI(GGA)
Plasmid#231368PurposePle155-driven mRuby2, also encoding U6-driven sgRNA cassette, with SapI sites to clone crRNA sequenceDepositorInsertmRuby2
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-Ple155-CI-EGFP-W3SL-BC(p1-10)
Plasmid#231351PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from Ple155 element, active in Purkinje cells.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-CMVe-SCP1-TagBFP2-W3SL-BC(p1-10)
Plasmid#231354PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses TagBFP from SCP1 promoter and CMV enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-NLS-EGFP-WPRE-SV40pA-T7-T3-BC(p1-14)
Plasmid#231345PurposeSingle stranded AAV genome with components for tracking AAV genome via AAV-Zombie. Also expresses a nuclear localized EGFP from CAG promoter.DepositorInsertT7/T3-BC(p1-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-HA-TadA8e-Sauri-U6-Camk2d sgRNA7
Plasmid#220127PurposeExpresses SauriABE8e by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoter, and add an HA tag fused to TadADepositorInsertMYL2, TadA, nSauriCas9
UseAAVTagsHA tagPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-inteinC-Sauri C aa439-1061-U6-Camk2d sgRNA7
Plasmid#220129PurposeExpresses Sauri cas9C by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, inteinC, nSauri Cas9C
UseAAV and CRISPRExpressionMammalianPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-TadA8e-SpN aa2-713- inteinN-U6-Camk2d sgRNA7
Plasmid#226915PurposeExpresses TadA8e and Sp cas9N by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, TadA, nSp Cas9N, inteinN
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-inteinC-SpC aa714-1368-U6-Camk2d sgRNA7
Plasmid#226916PurposeExpresses Sp cas9C by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, inteinC, nSp Cas9C
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-HA-TadA8e-Sauri N aa1-438-inteinN-U6-Camk2d sgRNA7
Plasmid#226678PurposeExpresses TadA8e and Sauri cas9N by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, TadA, nSauri Cas9N, inteinN
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
TMD20
Plasmid#163675PurposeExpresses a ST6GAL1 mutant with 20 amino acids in its TMD in mammalian cellsDepositorInsertpartial length ST6 beta-galactoside alpha-2,6-sialyltransferase 1 mutant (ST6GAL1 Human)
TagsGFPExpressionMammalianMutationFor this partial length ST chimera, two restricti…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
TMD21
Plasmid#163676PurposeExpresses a ST6GAL1 mutant with 21 amino acids in its TMD in mammalian cellsDepositorInsertpartial length ST6 beta-galactoside alpha-2,6-sialyltransferase 1 mutant (ST6GAL1 Human)
TagsGFPExpressionMammalianMutationFor this partial length ST chimera, two restricti…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
TMD22
Plasmid#163677PurposeExpresses a ST6GAL1 mutant with 22 amino acids in its TMD in mammalian cellsDepositorInsertpartial length ST6 beta-galactoside alpha-2,6-sialyltransferase 1 mutant (ST6GAL1 Human)
TagsGFPExpressionMammalianMutationFor this partial length ST chimera, two restricti…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
TMD24
Plasmid#163678PurposeExpresses a ST6GAL1 mutant with 24 amino acids in its TMD in mammalian cellsDepositorInsertpartial length ST6 beta-galactoside alpha-2,6-sialyltransferase 1 mutant (ST6GAL1 Human)
TagsGFPExpressionMammalianMutationFor this partial length ST chimera, two restricti…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTCO2-mTDGi.2
Plasmid#149431PurposeminiTdg gene, SUMOylation mutantDepositorInsertTdg (Tdg Mouse)
UseCre/LoxExpressionMammalianMutationK341A SUMOylation mutant, SNPs of Tdg gene in OLA…PromoterTdg promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTCO2-mTDGi.1
Plasmid#149430PurposeminiTdg gene, catalytic mutantDepositorInsertTdg (Tdg Mouse)
UseCre/LoxExpressionMammalianMutationN151A catalytic mutant, SNPs of Tdg gene in OLA/1…PromoterTdg promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-PIWIL2 ts2
Plasmid#115870PurposePIWIL2 knockdownDepositorAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
MPP5 gRNA (BRDN0001148199)
Plasmid#76943Purpose3rd generation lentiviral gRNA plasmid targeting human MPP5DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MPP5 gRNA (BRDN0001147829)
Plasmid#76944Purpose3rd generation lentiviral gRNA plasmid targeting human MPP5DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MPP5 gRNA (BRDN0001147491)
Plasmid#76945Purpose3rd generation lentiviral gRNA plasmid targeting human MPP5DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPN089
Plasmid#91614PurposeExpress sgRNA targeting human FURINDepositorAvailable SinceOct. 12, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAcGP67A-mMD2-proA
Plasmid#187878Purposebaculovirus protein expression of mouse MD-2 (residues 19–160) fused to a protein A tagDepositorAvailable SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Ikka-HA WT
Plasmid#23296DepositorAvailable SinceMarch 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Ikka-HA (K44M)
Plasmid#23297DepositorAvailable SinceApril 12, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCR-HA-IKKalpha
Plasmid#15469DepositorAvailable SinceOct. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-AGO2 ts1
Plasmid#115853PurposeAGO2 knockdownDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-AGO2 ts2
Plasmid#115854PurposeAGO2 knockdownDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-sh4EBP2
Plasmid#81121Purposeexpresses an shRNA targeting murine 4E-BP2DepositorInsert4E-BP2 shRNA (Eif4ebp2 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6Available SinceSept. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-AGO1 ts1
Plasmid#115850PurposeAGO1 knockdownDepositorAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-AGO1 ts3
Plasmid#115847PurposeAGO1 knockdownDepositorAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pscAAV.T7-SP6-BC(p11-14)-CAG-EGFP-SV40pA-T7
Plasmid#231350PurposeSelf complementary AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses EGFP from CAG promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-mDLX-minBG-CI-mRuby2-W3SL-T7
Plasmid#231352PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from minBG promoter with mDLX enhancer.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-minBG-CI-mRuby2-W3SL-T7
Plasmid#231353PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from minBG promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-SCP1-tdTomato-W3SL-T7
Plasmid#231356PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses tdTomato from SCP1 promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-CMVp-CI-mRuby2-W3SL-T7
Plasmid#231357PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from CMV promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-Ef1s-CI-mRuby2-W3SL-T7
Plasmid#231358PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from Ef1s promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only