We narrowed to 27,982 results for: STI
-
Plasmid#103580PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-503-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-503-5p target (MIR503 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-19a-5p
Plasmid#103324PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-19a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-19a-5p target (MIR19A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-202-5p
Plasmid#103335PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-202-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-202-5p target (MIR202 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-190a-3p
Plasmid#103297PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-190a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-190a-3p target (MIR190A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-1307-5p
Plasmid#103215PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-1307-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-1307-5p target (MIR1307 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-1287-3p
Plasmid#103203PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-1287-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-1287-3p target (MIR1287 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-1287-5p
Plasmid#103204PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-1287-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-1287-5p target (MIR1287 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-1185-1-3p
Plasmid#103180PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-1185-1-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-1185-1-3p target (MIR1185-1 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-1185-2-3p
Plasmid#103181PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-1185-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-1185-2-3p target (MIR1185-2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-10a-5p
Plasmid#103177PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-10a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-10a-5p target (MIR10A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-10b-3p
Plasmid#103178PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-10b-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-10b-3p target (MIR10B Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-10b-5p
Plasmid#103179PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-10b-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-10b-5p target (MIR10B Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSCAR_sgRNA_blast-tagBFP-lox5171
Plasmid#162072Purpose3rd generation lentivirus sgRNA delivery backbone with Cre-removable tagBFP reporter and blasticidin resistanceDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a myc tagged mbIL2 IRES miRFP720-P2A-Blast
Plasmid#248031PurposeConstitutively expresses myc tagged membrane bound IL2, miRFP720 and a blasticidin resistance gene in human cellsDepositorInsertmyc-tagged membrane bound IL2 (IL2 Human)
UseLentiviralExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a myc tagged mbIL15 IRES miRFP720-P2A-Blast
Plasmid#248032PurposeConstitutively expresses myc tagged membrane bound IL15, miRFP720 and a blasticidin resistance gene in human cellsDepositorInsertmyc-tagged membrane bound IL15 (IL15 Human)
UseLentiviralTagsMycExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-ERK2-L4A-MEK1_fusion
Plasmid#39197DepositorTagsMycExpressionMammalianMutationL4A = L33A, L37A, L40A, L42APromoterCMVAvailable SinceJuly 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDRM166 LKB (Luciferase mKate2 Blast)
Plasmid#183502PurposeExpresses the firefly luciferase gene, the NLS-tagged mKate2 gene, and the blasticidin resistance gene joined by P2A linkers.DepositorInsertsFirefly Luciferase
mKate2
BSD
UseLentiviral and LuciferaseTagsP2A linker and SV40 NLS with GGS linkerExpressionMammalianPromoterMND, MND (off Luc-P2A), and MND (off Luc-P2A-mKat…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
CA-RIT-NFAT1 (IRES-GFP)
Plasmid#85181PurposeConstitutively active NFAT1, mutated to interfere selectively with the NFAT:AP-1 interaction. Co-expresses EGFP for selectionDepositorInsertCA-RIT-NFAT1 (Nfatc2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationAmino acids 1-3 removed; CA: PASSGSSASF mutated t…Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.BSD
Plasmid#57821PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Blasticidin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only