We narrowed to 5,133 results for: codon optimized
-
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-ABE8e(V106W)-SpRY-BPNLS-P2A-EGFP (CA136)
Plasmid#208291PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e(V106W) A-to-G base editor with SpRY(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e(V106W)-SpRY-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations and V106W in TadA and nSpRY(D10A/…PromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-SpCas9-NRTH-P2A-EGFP (RMD63)
Plasmid#197500PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE(8.20) A-to-G base editor with nSpCas9-NRTH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8.20m-nSpCas9-NRTH-BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA and nSpCas9-NRTH(D10A/I…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-CE-ABE8e-SpRY--BPNLS-P2A-EGFP (NK289)
Plasmid#208293PurposeCMV and T7 promoter expression plasmid for human codon optimized CE-ABE8e-SpRY A-to-G base editor and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-CE-ABE8e-SpRY-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA inlaid into nSpRY(D10A/A6…PromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM155: pAAV.CMV-Cas13e (GenScript CO)-NT sgRNA
Plasmid#203451PurposePlasmid expressing active and codon optimised Cas13e with non-targeting gRNADepositorInsertsU6-non targeting (NT) sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianMutationCodon optimised using GenScript toolPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOPINB-HOIL-1 full-length (1–510)
Plasmid#193858PurposeExpression of human His-tagged HOIL-1 (RBCK1) full-length (1–510) codon optimized for E. coliDepositorInsertHOIL-1 (RBCK1 Human)
Tags3C protease cleavage site and 6x-His tagExpressionBacterialMutationCodon optimised for expression in E. coliPromoterT7Available SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZE21/UBP1/ClpS_V65I
Plasmid#98567PurposeExpresses truncated codon-opt S. cerevisiae UBP1 and the V65I engineered variant of E. coli ClpS in an artificial operonDepositorInsertsTruncated ubiquitin cleavase, codon optimized
Mutated ATP-dependent Clp protease adapter protein
ExpressionBacterialMutationContains the V65I mutation that increases discrim…Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATX3-77Q
Plasmid#184249PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertAtaxin-3 full length with 3 UIMs and 77Q in the Poly-Q track (ATXN3 Human, Synthetic)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationCodon optimization for protein expression in BL2…PromoterT7 promoterAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATX3-77Q-R388G
Plasmid#184251PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track-R388G fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track and point mutation R388G (ATXN3 Human, Synthetic)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationC-terminal codon optimization for protein expres…PromoterT7 promoterAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCas9-Blast
Plasmid#52962PurposeExpresses human codon-optimized S. pyogenes Cas9 protein and blasticidin resistance from EFS promoter. 3rd generation lentiviral backbone.DepositorHas ServiceLentiviral PrepInsertsCas9
Blasticidin resistance
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS-NSAvailable SinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIntegrase_9
Plasmid#60580Purposeplasmid contains the integrase gene under the control of the arabinose-inducible promoter, PbadDepositorInsertIntegrase_9
ExpressionBacterialMutationCodon optimized for E.coliPromoterpBADAvailable SinceMarch 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-PE-bacteria
Plasmid#172715PurposeExpression of an E. coli codon optimized fusion protein of Cas9n-linker-M-MLV2 for prime editingDepositorInsertCas9n-linker-M-MLV2
ExpressionBacterialMutationH840A of Cas9Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIW601-KmCRISPR
Plasmid#98907PurposeK. marxianus CRISPR Plasmid for sgRNA cloningDepositorInsertsCodon optimized Cas9
sgRNA expression cassette
UseCRISPR and Synthetic BiologyTagsSV40ExpressionYeastAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMM119
Plasmid#127213PurposeBeYDV replicon with constitutive GFP expression, WUS2, sgRNA targeting PDSDepositorInsertGFP, WUS2, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
p415TEF cyto roGFP2-Grx1(yeast)
Plasmid#65004PurposeYeast expression plasmid for roGFP2-Grx1; yeast codon optimized roGFP; yeast Grx1DepositorInsertGlutaredoxin-1
TagsroGFP2ExpressionYeastAvailable SinceJune 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBad-sfGFP
Plasmid#85482PurposeArabinose inducible E. coli codon optimized superfolder GFP with C-terminal His6 tagDepositorInsertsuperfolder GFP
Tags6x HisExpressionBacterialPromoterArabinoseAvailable SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-dCas9-Dnmt3a-Dnmt3l-P2A-eGFP
Plasmid#128424PurposeHuman Codon Optimized dCas9-DNMT3A3LDepositorInsertdCas9m4-sv40NLS-DNMT3A-3L-sv40NLS-P2A-eGFP
UseCRISPR and LentiviralTagsGFPExpressionMammalianPromoterT7 PromoterAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pN7CAST
Plasmid#190661PurposeExpresses polycistronic N7 CAST where Cas12k-T2A-TnsC and TniQ-T2A-TnsB are separated by an EMCV IRESDepositorInserthuman codon optimized N7Cas12k, N7TnsC, N7TniQ, N7TnsB
ExpressionMammalianPromoterCMVAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pN7HELIX
Plasmid#190662PurposeExpresses polycistronic N7 HELIX where Cas12k-T2A-TnsC and TniQ-T2A-nAniI_TnsB are separated by an EMCV IRESDepositorInserthuman codon optimized N7Cas12k, N7TnsC, N7TniQ, nAniI_N7TnsB
ExpressionMammalianMutationnAniI = K227M, F80K, L232KPromoterCMVAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRBC-sfGFP-150TAG
Plasmid#174076PurposePlasmid with p15a origin of replication expressing codon optimized superfolder GFP-150 TAG with C-terminal His6 tag, under T7 promoter,DepositorInsertSuperfolder GFP
TagsHis-6ExpressionBacterialMutationN150TAGPromoterT7Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only