We narrowed to 578 results for: crispr v2
-
Plasmid#84506PurposeMESA target chain with V2-MESA ectodomain, 35 extracellular linkers, a flag tag, M cleavage sequence, and dCas9-VP64DepositorInsertV2-MESA-35F-M-dCas9
UseLentiviralTagsFlagExpressionMammalianPromoterCMVAvailable SinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-puro-v2-no-scaffold
Plasmid#228521PurposeCROP-seq-puro-v2 with scaffold sequence removed for the insertion of CRISPRmap Opool with guide, scaffold and barcode sequencesDepositorInsertsUseLentiviralAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-mTurquoise2-v2-no-scaffold
Plasmid#228522PurposeCROP-seq-puro-v2 with scaffold sequence removed for the insertion of CRISPRmap Opool with guide, scaffold and barcode sequences, using mTurquoise2 as selection markerDepositorInsertmTurquoise2
UseLentiviralAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-copGFP-v2-no-scaffold
Plasmid#228520PurposeCROP-seq-puro-v2 with scaffold sequence removed for the insertion of CRISPRmap Opool with guide, scaffold and barcode sequences, using copGFP as selection markerDepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-mTagBFP2-NLS-BsmBI_entry (pRW1506)
Plasmid#225754PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with nuclear-localized mTagBFP2-NLS; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-palmitoyl-mTagBFP2-BsmBI_entry (pRW1509)
Plasmid#225755PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with membrane-localized palmitoyl-mTagBFP2; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v2)-PGK-Puro-BFP
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1179 U6-reci Gag-Cas9 v2
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1180 U6-reci Gag-pol v2
Plasmid#201915PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-pol
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-SpCas9-P2A-Puro-BsmBI_entry (pRW1512)
Plasmid#225756PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with expression of SpCas9 and Puromycin resistance; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR_mCherry
Plasmid#229078PurposeSmall lentiviral backbone for CRISPR guide libraries, improved titre for hard to transduce cellsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterEF1sAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_4
Plasmid#192688PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #4
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_1
Plasmid#192685PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #1
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_2
Plasmid#192686PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #2
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_3
Plasmid#192687PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #3
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 RFP670
Plasmid#187646Purposelentiviral vector expressing RFP670 alongside Cas9 and an sgRNA cloning siteDepositorInsertRFP 670
UseLentiviralTagsRFP670 and sgRNA cloning sitePromoterEFS (P2A)Available SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+3
Plasmid#121176PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+4
Plasmid#121177PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only