We narrowed to 14,247 results for: RON
-
Plasmid#162513PurposeAAV vector plasmid expressing enhanced green fluorescent protein (eGFP) under the mouse phosphoglycerate kinase (mPGK) promoter that is upstream of a beta-globin intronDepositorInserteGFP
UseAAVExpressionMammalianPromotermPGKAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV Puro DEST P38KTRDronpa
Plasmid#205763PurposeExpression of P38 KTR Dronpa under CMV promoter (With Puromycin Resistance)DepositorInsertP38 KTR Dronpa
UseLentiviralExpressionMammalianMutationwtAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNAintron-CHIKV-Structural polyprotein
Plasmid#215698PurposeProduces the Chikungunya virus structural polyprotein Capsid-E3-E2-6K-E1DepositorInsertCHIKV structural polyprotein Capsid-E3-E2-6K-E1
ExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTarget-RFP-GFP operon
Plasmid#192279PurposeRFP GFP fusion protein expressed under a constitutive promoterDepositorInsertRFP GFP
ExpressionBacterialPromoterPlacIqAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2214 - Intron GG1 - 900 bp
Plasmid#159880PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG1 - 900 bp
ExpressionWormMutationNot applicableAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1359 - Intron GG2 - smu-1
Plasmid#159805PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG2 - smu-1
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Chronos-GFP
Plasmid#122098PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter (1.1kb short version). Using SV40 pA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1α (1.1 kb short version)Available SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTBL681 CHYRON4 integration construct
Plasmid#126449PurposeTo integrate the CHYRON4 locus at AAVS1 in human cells.DepositorInsertspU6/3xLacO-CHYRON4 hgRNA
pCMV-puro
ExpressionMammalianMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterCMV and human U6/3xLacOAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Chronos(M140T)-mRuby2-ST
Plasmid#109129PurposeModified cation channelrhodopsin Chronos fused to mRuby2 fluorophore and targeted to the neuronal soma and proximal dendritesDepositorInsertChronos(M140T)-mRuby2-ST
ExpressionMammalianPromoterCAGAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only