We narrowed to 59,820 results for: SAP
-
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pLX307/PTPN11 T73I
Plasmid#140939Purposeexpresses PTPN11 T73IDepositorInsertPTPN11 protein tyrosine phosphatase non-receptor type 11 [ Homo sapiens (human) ] (PTPN11 Human)
UseTagsV5ExpressionMammalianMutationT73IPromoterEF1aAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX307/PTPN11 E76G
Plasmid#140862Purposeexpresses PTPN11 E76GDepositorInsertPTPN11 protein tyrosine phosphatase non-receptor type 11 [ Homo sapiens (human) ] (PTPN11 Human)
UseTagsExpressionMammalianMutationE76GPromoterEF1aAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHLsec hSOD1
Plasmid#232481Purposevector for transient transfection expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTagsDYKDDDDK (FLAG-tag)ExpressionMammalianMutationPromoterCAGAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
OMM-short-RspA-CFAST
Plasmid#233594PurposeExpression of RspA-CFAST on the outer mitochondrial membraneDepositorInsertTOM70 fragment-RspA-CFAST (TOMM70 Human, RspA-CFAST from Rheinheimera sp A13L and TOM70 fragment from Homo sapiens)
UseTagsExpressionMammalianMutationPromoterCMVAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 FFSS-BACH1 C122E
Plasmid#232274PurposeExpression of N-terminal tagged 2xFLAG-2xSTREP-BACH1 (H. sapiens) with Cys122 to Glu point mutation in human cell linesDepositorInsertBACH1 (BACH1 Human)
UseTags2xFLAG-2xSTREPExpressionMammalianMutationchanged cysteine 122 to glutamic acidPromoterCMVAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(RUNX1(13))-hU6gRNA5(RUNX3(12))-PGKpuroBFP-W
Plasmid#208569PurposeLentiviral vector expressing gRNA targeting human RUNX1 and RUNX3DepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(RUNX1(13))-hU6gRNA5(RUNX3(13))-PGKpuroBFP-W
Plasmid#208570PurposeLentiviral vector expressing gRNA targeting human RUNX1 and RUNX3DepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MSH6_FBXO11
Plasmid#205859PurposeExpress mEGFP-tagged fusion protein, MSH6_FBXO11 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only