We narrowed to 2,314 results for: sgc
-
Plasmid#215944PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD47_v5 [Sp]; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA232
Plasmid#215940PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surface with 2xPP7 & 2xMS2 in trRNADepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD47_v4 [Sp]; trRNA_v14 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA238
Plasmid#215942PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD47_v4 [Sp]; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA285
Plasmid#215947PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD81_v1; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA023
Plasmid#215931PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD81_v1 [Sp]; trRNA_v2 [Sp]; CS2
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
J8AAV-HDR Ctnnb1.1
Plasmid#73452PurposeJ8AAV-HDR U6sgCtnnb1.1 templateDepositorInsertCtnnb1 (Ctnnb1 Mouse)
UseAAVAvailable SinceFeb. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmcGAS
Plasmid#208385PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine cGAS gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
GUCY2D gRNA (BRDN0001146790)
Plasmid#76031Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2DDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUCY2D gRNA (BRDN0001146190)
Plasmid#76032Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2DDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUCY2D gRNA (BRDN0001147902)
Plasmid#76033Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2DDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUCY2D gRNA (BRDN0001145533)
Plasmid#76034Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2DDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only