We narrowed to 22,697 results for: TES
-
Plasmid#136359PurposeBacterial expression of recombinant Arabidopsis thaliana GUN1 (amino acids 232 to 708)DepositorInsertcDNA of Arabidopsis thaliana GUN1 corresponding to amino acids 232 to 708 (GUN1 Mustard Weed)
TagsTRX-HisExpressionBacterialPromoterT7Available SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET48 AtGUN1-PPR2
Plasmid#136360PurposeBacterial expression of recombinant Arabidopsis thaliana GUN1 (amino acids 232 to 619)DepositorInsertcDNA of Arabidopsis thaliana GUN1 corresponding to amino acids 232 to 619 (GUN1 Mustard Weed)
TagsTRX-HisExpressionBacterialPromoterT7Available SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3−3xFLAG−AGO2(S387D)
Plasmid#220463PurposeExpress S387 phosphomimetic mutant human AGO2 with N-terminal 3xFLAG tag in mammalian cellsDepositorInsertHuman AGO2 (AGO2 Human)
Tags3xFLAGExpressionMammalianMutationSerine 387 to aspartatePromoterCMVAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-NLS-Beta-catenin-S33Y
Plasmid#138537PurposeFor making Beta-catenin-S33Y RNADepositorInsertBeta-catenin
UseIn vitro transcriptionTags2XFLAG and 2xNLSMutationchanged serine 33 to tyrosinePromoterT7Available SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRQ-hRasV12
Plasmid#18113DepositorInserth-RasV12G (HRAS Human)
UseRetroviralExpressionMammalianMutationG12V, constitutively activeAvailable SinceFeb. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMAL-PUM2
Plasmid#120385PurposeBacterial expression of MBP-Pumillio2 fusion proteinDepositorAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
prk5-MFSD12-TEV-3xFLAG-3xHA
Plasmid#149504PurposeTransient expression of human MFSD12 with recoded nucleotide sequence.DepositorInsertMFSD12 (MFSD12 Human)
UseTransient expressionTagsTEV-3XHA-3XFLAGExpressionMammalianMutationCodon Optimized SequencePromoterCMVAvailable SinceNov. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-V5-PTPN14-del-N
Plasmid#61004PurposeExpresses human PTPN14 (del-FERM domain mutant) in mammalian cells, N-terminus V5 tagDepositorInsertPTPN14 delete N (PTPN14 Human)
TagsV5 tagExpressionMammalianMutationdeleted amino acids 17-310PromoterCMVAvailable SinceNov. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYPQ239
Plasmid#108859PurposeFnCpf1 Gateway entry plasmidDepositorInsertFnCpf1
UseCRISPR; Gateway compatible cpf1 entry cloneTagsNLSExpressionPlantMutationCpf1 is rice codon optimizedAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only