We narrowed to 14,509 results for: SHR;
-
Plasmid#74377PurposegRNA_B to knockout human AMPK alpha 2 using Cas9nDepositorAvailable SinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pLKO.1-shSNAI1
Plasmid#115467PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-BRD4ΔN-miRFP670-Cry2WT
Plasmid#122439PurposeExpresses disordered protein BRD4(462-1362) fused with fluorescent protein miRFP670 and optogenetic protein Cry2WTDepositorInsertBRD4 (BRD4 Human)
UseLentiviralTagsCry2WT and miRFP670ExpressionMammalianMutationDeleted amino acids 1-461PromoterSFFVAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-EWSR1-gRNA
Plasmid#237683PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to EWSR1 locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA3 gRNA (BRDN0001144943)
Plasmid#75942Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLC-BFP-FADD
Plasmid#75166PurposeLentiCRISPR-BFP with sgRNA targeting human FADDDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA3 gRNA (BRDN0001148452)
Plasmid#75943Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP13-AAV-H1/TO-L-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82703PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_nsgRNA(PP7)
Plasmid#232434PurposensgRNA for PE3b correction of the rd6 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only