We narrowed to 29,541 results for: REP
-
Plasmid#187178PurposeExpress histone H2B tagged with miniTurbo under the control of CAG promoterDepositorInserthistone H2B fused with miniTurbo (BirA mutant)
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TARG1
Plasmid#172577PurposeFor gateway cloning of C-terminal tagged TARG1 constructs.DepositorInsertTARG1 (OARD1 Human)
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR/zeo-TARG1
Plasmid#172574PurposeFor gateway cloning of N-terminal tagged TARG1 constructs.DepositorInsertTARG1 (OARD1 Human)
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRTagsExpressionMutationS264A, and silent mutation to remove PAM sitePromoterAvailable sinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSP64T-ythdf3-3xflag
Plasmid#164490PurposeExpresses zebrafish ythdf3 with 3x flag tag, for mRNA injectionDepositorInsertythdf3 (ythdf3 Zebrafish)
UseProduction of mrna for zebrafish injection.Tags3x-flagtagExpressionMutationPromoterSP6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
EC0_3_Mxi1
Plasmid#163715PurposePlasmid encoding Mxi1 - SV40 NLS as a Type 4a part to be used in the Dueber YTK system (MoClo kit)DepositorInsertMxi1+SV40 NLS
UseSynthetic Biology; Moclo vector level 0 (type 4a)TagsExpressionMutationPromoterAvailable sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
EC0_6_sgRNA
Plasmid#163717PurposePlasmid encoding a placeholder sequence as a Type 234 part to be used in the Dueber YTK system (MoClo kit)DepositorInsertsgRNA expression cassette
UseSynthetic Biology; Moclo vector level 0 (type 234)TagsExpressionMutationPromoterAvailable sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
EC0_4_VPR
Plasmid#163716PurposePlasmid encoding VPR (VP64 - SV40 NLS - p65 - Rta) as a Type 4a part to be used in the Dueber YTK system (MoClo kit)DepositorInsertVPR
UseSynthetic Biology; Moclo vector level 0 (type 4a)TagsExpressionMutationPromoterAvailable sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
PylT(AGGA)Ev2 PylS mCherry-P2A-eGFP(AGGA)
Plasmid#174528PurposeDual-fluorescence reporter for quantifying PylT(AGGA)Ev2 decoding efficiencyDepositorInsertPylS
UseTagsFlagExpressionMammalianMutationPromoterAvailable sinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-CT-Tagging
Plasmid#165871PurposeTemplate for amplification of EGFP C-terminal tagging cassetteDepositorInsertVector - CT Tagging
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
p3xP3
Plasmid#165779Purpose3xP3 eye driver enhancer element, requires promoter element for functionDepositorInsert3xP3
UseTagsExpressionInsectMutationPromoterAvailable sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-CT-Tagging
Plasmid#165869PurposeTemplate for amplification of mcherry C-terminal tagging cassetteDepositorInsertVector - CT Tagging
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD2
Plasmid#165857Purposeuniversal Vector Domesticator vector v2 used in the integration (domestication) of new vector backbone parts in the GB2.0 cloning system. Uses blue-white screening methodDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-NT-Tagging
Plasmid#165868PurposeTemplate for amplification of EGFP N-terminal tagging cassetteDepositorInsertVector - NT Tagging
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSV40L-TN
Plasmid#165827PurposeViral Simian virus 40 Late poly(a) terminator element Compatible with transposon 3' ITRsDepositorInsertSV40L
UseTagsExpressionInsectMutationPromoterAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGGSx4 CT
Plasmid#165811PurposeFlexible peptide linker of 4 repeats of GGS, for assembly of C-terminal TL5 tags to TL4 partsDepositorInsertGGSx4 CT
UseTagsExpressionInsectMutationPromoterAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
p4xLexAOp-A1
Plasmid#165814PurposeAlpha1 4xLexAOp for assembly of larger LexAOp response elementsDepositorInsert4xLexAOp-A1
UseTagsExpressionInsectMutationPromoterAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
p4xLexAOp-A2
Plasmid#165815PurposeAlpha2 4xLexAOp for assembly of larger LexAOp response elementsDepositorInsert4xLexAOp-A2
UseTagsExpressionInsectMutationPromoterAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
p4xLexAOp-O2
Plasmid#165816PurposeOmega2 4xLexAOp for assembly of larger LexAOp response elementsDepositorInsert4xLexAOp-O2
UseTagsExpressionInsectMutationPromoterAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
p4xLexAOp-O1
Plasmid#165817PurposeOmega1 4xLexAOp for assembly of larger LexAOp response elementsDepositorInsert4xLexAOp-O1
UseTagsExpressionInsectMutationPromoterAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only