We narrowed to 238 results for: Streptavidin
-
Plasmid#228524PurposeLentiviral vector, expresses Strep-KDEL-IRES-SBP-(Rat)LAMP1-V5-APEX2 in mammalian cells.DepositorInsertLAMP1 (Lamp1 Rat)
UseLentiviralTagsStreptavidin Binding Protein (SBP), Streptavidin-…ExpressionMammalianPromoterUbcAvailable sinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFP5299 ss-FIREmate-HA- KDEL-IVS-IRES- ManII-SBP- mApple-FIREtag
Plasmid#216695PurposeSynchronize anterograde and retrograde trafficking of ManII between ER and Golgi (RUCH system)DepositorInsertsTagsFIREtag, Streptavidin Binding Protein (SBP), and …ExpressionMammalianMutationcontains only amino acids 1 to 116 of ManIIPromoterCMVAvailable sinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
SBP-ST*-GFP
Plasmid#163668PurposeExpresses SBP tagged partial length ST in mammalian cellsDepositorInsertpartial length ST6 beta-galactoside alpha-2,6-sialyltransferase 1 (first 113 amino acids) (ST6GAL1 Human)
TagsGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianMutationThis chimera contains the first 113 amino acids o…Available sinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST-SBP-mCherry_puromycin
Plasmid#65271PurposeST reporter only ( no hook) (RUSH system)DepositorInserttruncated sialyltransferase (ST6GAL1 Human)
TagsStreptavidin Binding Protein (SBP) and mCherryExpressionMammalianMutationcontains only amino acids 1 to 43 of STPromoterCMVAvailable sinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_CD63-SBP-EGFP
Plasmid#247324PurposeSynchronize the trafficking of CD63 from the ER.DepositorInsertCD63 (CD63 Human)
TagsSBP-EGFP (inserted in the small luminal loop of C…ExpressionMammalianPromoterCMVAvailable sinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
FUGW-RUSH-LAMP1-mScarleti
Plasmid#228526PurposeLentiviral vector, expresses Strep-KDEL-IRES-SBP-(Rat)LAMP1-mScarleti in mammalian cells.DepositorInsertLAMP1 (Lamp1 Rat)
UseLentiviralTagsStreptavidin Binding Protein (SBP), Streptavidin-…ExpressionMammalianPromoterUbcAvailable sinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
str-KDEL_Stx5LdeltaER-SBP-mCitrine
Plasmid#154846PurposeSynchronize trafficking of Stx5LdeltaER (M55V) from the ER, for use with FLIM (RUSH system)DepositorInsertStx5 (Long isoform) (STX5 Human)
TagsStreptavidin Binding Protein (SBP) and mCitrineExpressionMammalianMutationChanged Methionine 55 to Valine, causes loss of S…PromoterCMVAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
flGalT-SBP-mCherry_puromycin
Plasmid#65276PurposeGalT reporter only ( no hook) (RUSH system)DepositorInsertgalactosidase
TagsStreptavidin Binding Protein (SBP) and mCherryExpressionMammalianPromoterCMVAvailable sinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
L3MBTL3 (3UT1)
Plasmid#36901PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertL3MBTL3 (L3MBTL3 Human)
TagsHis tag and Streptavidin-Binding Peptide (SBP)-Ta…ExpressionBacterialMutationcontains amino acid residues 228-551 onlyAvailable sinceJune 21, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available sinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available sinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34∆RBS
Plasmid#247213PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available sinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP35∆RBS
Plasmid#247214PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available sinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
FUGW-RUSH-Strep-KDEL
Plasmid#228527PurposeLentiviral vector, cloning vector for Strep-KDEL-IRES in mammalian cells.DepositorInsertStrep-KDEL
UseLentiviralTagsStreptavidin-KDELExpressionMammalianPromoterUbcAvailable sinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
str-KDEL_Stx5L(M55V)-SBP-mCitrine
Plasmid#209846PurposeSynchronize trafficking of Stx5L (M55V) from the ER, for use with FLIM (RUSH system)DepositorInsertSTX5 (STX5 Human)
TagsStreptavidin Binding Protein (SBP) and mCitrineExpressionMammalianMutationChanged Methionine 55 to Valine, causes loss of S…PromoterCMVAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
BMP10 N67Q N131Q D4G (S2-2)
Plasmid#184622Purposefor transfection into S2 cells and expression of BMP10 proteinDepositorInsertBMP10 (BMP10 Human)
Tags8x His - streptavidin binding peptideExpressionInsectMutationN67Q, N131Q, ARIRR(312-316) replaced with GAvailable sinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
str-KDEL_Stx5S-SBP-mCitrine
Plasmid#154845PurposeSynchronize trafficking of Stx5S from the ER, for use with FLIM (RUSH system)DepositorInsertStx5 (Short isoform) (STX5 Human)
TagsStreptavidin Binding Protein (SBP) and mCitrineExpressionMammalianMutationLacks amino acids 1-54, enocdes short isoform of …PromoterCMVAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBEL1957
Plasmid#155151PurposeExpresses Strep-MlaF-(6xHis-TEV-MlaB)DepositorInsertMlaF-(6xHis-TEV-MlaB)
Mutationadded Streptavidin tag on MlaF N-terminusPromoterT7 promoterAvailable sinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only