We narrowed to 14,223 results for: Cas9
-
Plasmid#196251PurposePlasmid for cloning the first CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag4-gRNA4
Plasmid#196255PurposePlasmid for cloning the 4th CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2T-gRNA2
Plasmid#196253PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA for guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
G9A[SET]-dCas9
Plasmid#100089PurposeCatalytic domain [SET] of human G9A fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertG9A (EHMT2 Human)
UseCRISPRTags3XFLag-NLS-G9A[SET]-dCas9-NLSExpressionMammalianMutationG9A[SET] includes aa 829-1209PromoterCMVAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-HypaCas9
Plasmid#108302PurposepX330 (Plasmid #42230) with the N692A, M694A, Q695A, and H698A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAC149-pCR8-dCas9VP160
Plasmid#48221PurposedCas9VP160 on Gateway donor vector pCR8/GW/TOPO. Note: This is not for expression. It has to be transferred to a gateway destination vector for expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCas9(D10A;H840A) fusion with VP160 activation domain
UseCRISPR and Gateway CloningTagsHA Tag and VP160MutationD10A;H840A nuclease-deficientAvailable sinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAC91-pmax-dCas9VP64
Plasmid#48223PurposedCas9VP64 on pmax expression vectorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCas9(D10A;H840A) fusion with VP64 activation domain
UseCRISPRTagsHA Tag and VP64ExpressionMammalianMutationD10A;H840A (catalytically inactive)PromoterCAGGSAvailable sinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pICH41308::hCas9
Plasmid#49770PurposeLevel 0 hCas9 moduleDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthCas9
UseCRISPRAvailable sinceDec. 18, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
SlugCas9-HF
Plasmid#163796PurposeExpresses highly specific SlugCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianMutationSlugCas9 (R247A, N415A, T421A, R656A)Available sinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAVS1_dCas9-XTEN-KRAB-p2A-mCherry
Plasmid#222107PurposeDonor vector for CRISPRi integration at AAVS1 with an mCherry fluorophoreDepositorInsertCRISPRi-kox1(KRAB) (cas9 Human, S. pyogenes)
UseAAV and CRISPRTagsHA and P2A-mCherryExpressionMammalianMutationD10A, H840AAvailable sinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-PE SpG
Plasmid#179081PurposeNOTE: An improved version of this plasmid is now available. See Addgene plasmid #242072. All-in-one prime editor piggyBac transposon, SpG variantDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpCas9 SpG_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsSV40 NLSExpressionMammalianMutationD1135L, S1136W, G1218K, E1219Q, R1335Q, T1337RPromoterCAGAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
SUV[SET]-dCas9
Plasmid#100088PurposeCatalytic domain [SET] of human SUVAR39H1 fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSUVAR39H1 (SUV39H1 Human)
UseCRISPRTags3XFLag-NLS-SUV[SET]-dCas9-NLSExpressionMammalianMutationdeleted aa 1-76PromoterCMVAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
iPEmax-WT
Plasmid#239385PurposeFor inverse prime editor using Cas9-R221K-N394K in HEK294T cellsDepositorInsertCas9-R221K-N393K, M-MLV-RT
UseCRISPRTagsBPNLS and SV40 NLS, c-myc NLSExpressionMammalianMutationR221K, N394K in Cas9PromoterCMVAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pyEvolvR (enCas9-PolI5M)
Plasmid#158073PurposeExpresses enCas9 fused to PolI5M in S. cerevisiae; contains a BsmbI-flanked GFP cassette for sgRNA cloning.DepositorInsertenCas9-PolI5M
ExpressionBacterial and YeastAvailable sinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tet1-dCas9
Plasmid#136650PurposeTet1 fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTet1 (Tet1 Mouse)
UseCRISPRTags3XFLag-NLS-Tet1-dCas9-NLSExpressionMammalianPromoterCMVAvailable sinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
BCJJ339
Plasmid#117501PurposeRPS5a:Cas9:E9 Golden Gate Level 1 Position 2DepositorInsertBpiI:GCAA:RPS5a:Cas9-3(intron):E9:ACTA:BpiI
UseCRISPRExpressionPlantPromoterAtRPS5aAvailable sinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CR102
Plasmid#234043Purposeexpresses ABE8e(V106W) - SpG Cas9 base editor in a human T cell optimized lentiviral transfer plasmidDepositorInsertTadA8e(V106W)-SpG-Cas9(D10A)-P2A-blast
UseLentiviralAvailable sinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-sgRNA-RFP
Plasmid#166005PurposeBacterial expression of dCas9 (aTc control) and sgRNA (arabinose control)DepositorTypeEmpty backboneUseCRISPRExpressionBacterialAvailable sinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX303-ABI1-dCas9
Plasmid#154474PurposeExpresses ABI1 fused to the N terminus of dCas9DepositorInsertABI1 (ABI1 Mustard Weed)
UseLentiviralExpressionMammalianMutationIncludes ABI1 aa 126-423, D143APromoterCMVAvailable sinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only