We narrowed to 7,229 results for: gan
-
Plasmid#70614PurposeGateway ORF clone of human SPRY2 [NM_005842.2] without stop codon (for C-terminal fusions)DepositorInsertSPRY2 (SPRY2 Human)
UseGateway CloningAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
sgRNA with rpr-1 promoter
Plasmid#48961Purposeto drive the sgRNA expression under RNase P non-coding RNA promoterDepositorPublicationTypeEmpty backboneUseCRISPRExpressionWormPromoterrpr-1 promoterAvailable sinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMLS234
Plasmid#73682PurposeSapTrap 3-site Destination vector for N-terminal GFP tagging with embedded Cbr-unc-119 selectable markerDepositorInsertGFP + Cbr-unc-119
UseCRISPR and Cre/LoxTagsGFPExpressionWormAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-DRE-1-pcDNA3.1-
Plasmid#52513Purposeexpresses C. elegans DRE-1 in mammalian cells with FLAG-HA tag at N-terminusDepositorAvailable sinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJM614-TRA-2::GFP
Plasmid#27128DepositorInsertTRA-2 GFP (tra-2 Nematode)
TagsGFPExpressionWormMutationreplaced stop codon with AgeI and EcoRI added GFP…Available sinceJan. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMDJ13 - pEXP[Peft-3 | tagRFP-T (NLS) | tbb-2 UTR]
Plasmid#159800PurposeExpression construct with ubiquitous expression to test fluorescence level on microscopeDepositorInsertpEXP[Peft-3 | tagRFP-T (NLS) | tbb-2 UTR]
ExpressionWormMutationNot applicableAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNM3649
Plasmid#154110PurposeminiMos dual component RMCE landing site vectorDepositorInsertloxP::SEC::loxP::rpl-28p::FRT::GFP::his-58::unc-54 3'::FRT3
UseMinimosPromoternot applicableAvailable sinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pClneoFH-let60 G12V
Plasmid#66860PurposeExpress FLAG-His6-tagged dominant active let60, in which Glycine 12 is mutated to Valine, in mammalian cellsDepositorInsertLet-60 (let-60 Nematode)
TagsFLAG-His6ExpressionMammalianMutationGlycine 12 is mutated to valinePromoterCMVAvailable sinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pIK137
Plasmid#65632PurposeExpresses gfp::h2b in C. elegans cells from the ubiquitous eef-1A.1 (eft-3) promoter and contains a C. briggsae unc-119 rescuing fragmentDepositorInsertPeft-3::gfp::h2b::tbb-2 3'UTR, C. briggsae unc-119 rescue fragment
ExpressionWormAvailable sinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGC276
Plasmid#19637DepositorInsertGateway(R1-R2)UseFlp/frt, destination vectorExpressionWormAvailable sinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGC163
Plasmid#19635DepositorInsertGateway(R1-R2)UseFlp/frt, destination vectorExpressionWormAvailable sinceFeb. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPD95.77-wVenus
Plasmid#37465DepositorTypeEmpty backboneExpressionWormPromoternoneAvailable sinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCFJ2240 - [1-2] ENTR - Fluor - ce-tagRFP-T (1 intron, syntrons(3), no_atg, no_stop)
Plasmid#159855PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-tagRFP-T (1 intron, syntrons(3), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable sinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2241 - [1-2] ENTR - Fluor - ce-mCardinal (1 intron, syntrons(3), no_atg, no_stop)
Plasmid#159860PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-mCardinal (1 intron, syntrons(3), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2300 - [1-2] ENTR - Fluor - ce-Dendra2(1 intron, syntrons(3), no_atg, no_stop)
Plasmid#159869PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-Dendra2(1 intron, syntrons(3), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2060 - [1-2] ENTR - Tag - Snap (intron(1), syntrons(3), no_atg, no_stop)
Plasmid#159873PurposeThree-fragment Gateway compatible protein tag for expression in C. elegansDepositorInsert[1-2] ENTR - Tag - Snap (intron(1), syntrons(3), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNM3749
Plasmid#154108PurposeloxP FRT FRT3 RMCE landing site in a Golden Gate SapI GCG ACG assembly vectorDepositorInsertsLoxP-SEC-LoxP
FRT::rpl-28p::GFP::his-58::FRT3
UseCre/Lox; RmceExpressionWormPromoternot applicableAvailable sinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOD2049-csnControl
Plasmid#100007PurposeMosSCI targeting vector expressing an ubiquitin ligase adaptor ZIF-1, serving as a control for pOD2048-csnDEG. Expression is controlled by Posm-6 (ciliated sensory neuron specific).DepositorInsertsUseTargeting vector for mos1 transposon mediated sin…Available sinceSept. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGC245
Plasmid#19638DepositorInsertGateway(R4-R3)UseFlp/frt, destination vectorTags4xNLSExpressionWormAvailable sinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only