We narrowed to 1,691 results for: CAG promoter
-
Plasmid#173202PurposeCoselection for PE3 or HDR in human cells. Vector for tandem expression of ATP1A1 G3 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G7_Dual_sgRNA
Plasmid#173206PurposeCoselection for HDR in human cells. Vector for dual expression of ATP1A1 G7 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G7 sgRNA + user-specified sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterDual U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Dual_pegRNA
Plasmid#173199PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 Q118R-G4 pegRNA with a user-specified pegRNA from two independent U6 promoters. pU6-pegRNA-GG-acceptor-like plasmidDepositorInsertATP1A1 G4 Q118R pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-3
Plasmid#121536PurposesgITGB4-3 sequence: GAGGAGCGTAGGTCCTCGCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-Casp2-shRNA
Plasmid#157926PurposeKnockdown of caspase-2DepositorAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-1
Plasmid#121535PurposesgITGB4-1 sequence: GAGGCGCAGTCCTTATCCACA. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G3_Dual_sgRNA
Plasmid#173205PurposeCoselection for HDR in human cells. Vector for dual expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterDual U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB1-3
Plasmid#121534PurposesgITGB1-3 sequence: GTTCAGTGAATGGGAACAACG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB1-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mIDUA)
Plasmid#170123PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse IDUA mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Idua Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only