We narrowed to 14,397 results for: ung
-
Plasmid#212900PurposeEncodes S.cerevisiae ECM14 pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertECM14 (ECM14 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD023
Plasmid#212909PurposeEncodes a hybrid S. cerevisiae OST1 pre- MFalpha1 pro- signal peptide (OST1MFapp) as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertMFalpha1 (MF(ALPHA)1 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD081
Plasmid#212918PurposeEncodes the HA-tagged S. cerevisiae Aga2p yeast surface display anchor protein as a Type 4a part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertAGA2 (AGA2 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD005
Plasmid#212902PurposeEncodes S. cerevisiae KSH1 pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertKSH1 (KSH1 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGIPz-mPD-L1
Plasmid#121488PurposeExpression of mouse PD-L1 WTDepositorInsertPD-L1
UseLentiviralTagsFlagExpressionMammalianPromoterCMVAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
Flag p21 WT
Plasmid#16240DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
Tag5Amyc-GSK3b CA
Plasmid#16261DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA
Plasmid#92392Purposeproduces AAV expressing Cal-light TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTADepositorInsertTM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA
UseAAV and Synthetic BiologyExpressionMammalianPromoterHuman SynapsinAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNS35 (multiAsCas12a piggyBac)
Plasmid#217336PurposepiggyBac expression of multiAsCas12aDepositorInsertmultiAsCas12a
UseCRISPRTags6xMycNLS and HA-SV40NLS-P2A-TagBFP2ExpressionMammalianMutationR1226A/E174R/S542R/K548RPromoterCAGAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-PuroR Xlone eGFP
Plasmid#179837PurposeDoxycycline-inducible expression of eGFPDepositorInserteGFP
UseCRISPR, Synthetic Biology, and TALEN ; Donor plas…ExpressionMammalianPromoterTRE3GSAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter hsa-let-7a-1
Plasmid#46670DepositorInserthsa-let-7a-1 (MIRLET7A1 Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianPromoterCMVAvailable SinceJuly 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-CDS
Plasmid#136039PurposeG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA-YY1
Plasmid#104395PurposeHA-YY1DepositorAvailable SinceJan. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCCL-NoPromoter-FLuc-CMV-RLuc-dsRed2
Plasmid#215329PurposeLentiviral mammalian vector with firefly luciferase gene with no upstream promoter sequence; renilla luciferase and dsRed2 reporter under CMV promoter.DepositorInsertNo Promoter
UseLentiviral and LuciferaseExpressionMammalianAvailable SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFC334
Plasmid#87846PurposeAMA1 plasmid with Aspergillus optimized Cas9, argB selection marker and yA specific sgRNA expressed with ribozymesDepositorInsertsCas9
argB
yA specific sgRNA
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterA. nidulans gpdA promoter with Hammerhead ribozym…Available SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFC333
Plasmid#87844PurposeAMA1 plasmid with Aspergillus optimized Cas9 and ble selection markerDepositorInsertsCas9
ble (bleomycin resistance marker)
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus nidulans tef1 promoter and Aspergillu…Available SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ-PD-L1-EGFP
Plasmid#120933PurposeExpress PD-L1-EGFP fusion protein in mammalian cellsDepositorInsertPD-L1-EGFP
ExpressionBacterialAvailable SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNH-TrxT-G-S10
Plasmid#127829PurposeProduction of recombinant human ribosomal protein S10DepositorAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCI-ASC-HA
Plasmid#41553DepositorInsertASC (PYCARD Human)
TagsHAExpressionMammalianPromoterCMV immediate-early enhancer/promoterAvailable SinceDec. 20, 2012AvailabilityAcademic Institutions and Nonprofits only