We narrowed to 5,916 results for: pAAV
-
Plasmid#129394PurposeSoma Targeted, High photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Uses the CAG promoter and double floxed.DepositorInsertsoma targeted ChRger2
UseAAV and Cre/LoxTagsKv2.1-TS-EYFPExpressionMammalianPromoterCAGAvailable SinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-TVA66T-EGFP
Plasmid#64091PurposeExpresses TVA66T-EGFP under the CAG promotorDepositorInsertTVA66T-EGFP
UseAAV and Cre/LoxTagsEGFPExpressionMammalianMutationGlutamic acid 66 to ThreoninePromoterCAGAvailable SinceApril 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.SV40.THBS1-deltaTSR1-HA.SV40(polyA)
Plasmid#156162PurposeExpresses murine Thrombospondin-1 (THBS1) with deletion (AA 383-548) and HA-tag at C-terminusDepositorInsertThrombospondin-1 (Thbs1 Mouse)
UseAAVTagsHA-tagExpressionMammalianMutationTHBS1 with deletion of amino acid residues 383-548PromoterCMVAvailable SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
206_pAAV-ProD17-CatCh-GFP-WPRE
Plasmid#125993PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD17Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eGFP-L10a
Plasmid#166605PurposeEncodes Cre-dependent eGFP-L10a under control of the TREDepositorInserteGFP-L10a
UseAAVPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
III_pAAV-ProB4-CatCh-GFP-WPRE
Plasmid#125924PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB4Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
70_pAAV-ProA23-CatCh-GFP-WPRE
Plasmid#125906PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA23Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
(326) pAAV SV40-ZsGreen U6-gRNA
Plasmid#163020PurposeFluorescent reporter for Sa gRNA (Bsa1 sites)DepositorInsertZs Green
UseAAVExpressionMammalianPromoterSV40Available SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-rsChRmine-eYFP-WPRE
Plasmid#183531PurposeOptogeneticsDepositorInsertrsChRmine-eYFP
UseAAVMutationI146M/G174SPromoterCaMKIIaAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
151_pAAV-ProC29-CatCh-GFP-WPRE
Plasmid#125964PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC29Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-EcYtR(NGS-6)-mCherry
Plasmid#217363PurposeExpresses E. coli tyrosine tRNA variant "NGS-6" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli tyrosine tRNA mutant, "NGS-6"
UseAAVExpressionMammalianPromoterU6Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-PytR(PyOtR)-mCherry
Plasmid#204870PurposeExpresses pyrrolysyl tRNA variant "PyOtR" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertM. mazei pyrrolysyl tRNA mutant "PyOtR"
UseAAVExpressionMammalianMutationU25C; A3G, A4C, A5G, C6G, G63C, T65G, T66CPromoterU6Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DO-ChETA-EYFP-WPRE-pA
Plasmid#37086PurposeExpresses ChETA-EYFP in cells lacking Cre (Cre-Off), for optogenetic excitationDepositorInsertChETA-YFP
UseAAV and Cre/Lox; Cre-offTagsEYFPPromoterEF1aAvailable SinceJuly 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-SnFR-gamma8-minWPRE
Plasmid#165498PurposeAAV for glutamate reporter fused to TARP gamma-8DepositorInsertiGluSnFR extracellular domain fused to TARP gamma-8 via NETO2 TM domain (Cacng8 Rat, Synthetic)
UseAAVPromoterhSynapsinAvailable SinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-hSyn1-NES-ChemoG-CaM
Plasmid#193817PurposeExpression of ChemoG-CaM in primary neuronsDepositorInsertChemoG-CaM
UseAAVMutationEGFP:A206K; HT7: L271EPromoterhSyn1Available SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-mDLX-TVA-2A-N2cG
Plasmid#172365PurposeTargeting envA-pseodotyped RVdG-CVS-N2c vectors for specific retrograde labeling from cre-expressing inhibitory neuronsDepositorInsertTVA + B19-N2cG
UseAAV and Cre/LoxExpressionMammalianPromotermDLXAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
17_pAAV-ProB1-CatCh-GFP-WPRE
Plasmid#125921PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB1Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FRT-JEDI-1P-Kv-WPRE
Plasmid#202617PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P flanked by FRT in AAV production vector expressed under the mammalian promoter (EF1a), FLP recombinase-dependentDepositorInsertFRT-JEDI-1P-Kv
UseAAV; Flp/frtExpressionMammalianPromoterEF1aAvailable SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-GRAB_r5-HT1.0
Plasmid#208725PurposeExpresses the red 5-HT sensor GRAB_r5-HT1.0 in neurons in the presence of Cre recombinaseDepositorInsertRed fluorescent 5-HT sensor GRAB_r5-HT1.0
UseAAVPromoterEF1aAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only