We narrowed to 4,603 results for: Abo
-
Plasmid#212660PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and a multiple cloning site (MCS) after an IRES sequenceDepositorInsertsUseLentiviralExpressionMammalianMutationD676A, D680AAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only
-
CamKII-mito4x- GCaMP6f-IRES2-rat-Letm1-ΔEFhand
Plasmid#212662PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and rat-Letm1 with mutations in its EF-handDepositorInsertsUseLentiviralExpressionMammalianMutationD676A, D680AAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1α-EGFP-WPRE
Plasmid#250407PurposeLentiviral expression of EGFP under EF1α core promoter.DepositorInsertEGFP
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1α-PPAT-WPRE
Plasmid#250408PurposeLentiviral expression of PPAT under EF1α core promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB OROV Gc Spike H6
Plasmid#229662PurposeMake PiggyBac stable cell line expressing Oropouche virus BeAn 19991 Gc spike region (residues 482–894 of M polyprotein) with C-terminal His6 tagDepositorInsertOROV Gc spike
UsePiggybacTags6xHisExpressionMammalianMutationcontains residues 482-894 onlyPromoterTREAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk13_Nterm_FlagHa
Plasmid#127343PurposeN-terminal Flag- HA- tandem epitope tagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into Gateway entry vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UseEntry vector with transgene for gateway cloningTagsFlag- HA- Tandem EpitopesMutationBase pairs 1-1554 of transgene are codon optimize…PromoterNoneAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-Neo-TetO-Cdk13_Untagged
Plasmid#127344PurposeUntagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into a dox-inducible piggybac destination vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UsePiggybac transposase vectorTagsNoneExpressionMammalianMutationBase pairs 1-1554 of transgene are codon optimize…PromoterTetO PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-Neo-TetO-Cdk13_Nterm_FlagHa
Plasmid#127345PurposeN-terminal Flag- HA- tandem epitope tagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into a dox-inducible piggybac destination vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UsePiggybac transposase vectorTagsFlag- HA- Tandem EpitopesExpressionMammalianMutationBase pairs 1-1554 of transgene are codon optimize…PromoterTetO PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
DRH016_ AAV-hSyn-DN-THR
Plasmid#225089PurposeExpression of dominant-negative thyroid receptor beta (THRB, human) with an HA tag in neurons driven by human synapsin promoter.DepositorInsertDN-THRB (THRB Human)
UseAAVAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-2P-N317P
Plasmid#196378PurposeMammalian cell expression of SARS-CoV-2 Spike protein with mutation N317P with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertS-GSAS-2P-N317P (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5K85R-VA
Plasmid#98691PurposeLentiviral expression of human PRDX5-K85R in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationK85RPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5E80K-VA
Plasmid#98689PurposeLentiviral expression of human PRDX5-E80K in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationE80KPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5K83R-VA
Plasmid#98690PurposeLentiviral expression of human PRDX5-K83R in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationK83RPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLEX_307-SOD1E133K
Plasmid#83447PurposeMammalian expression of SOD1E133KDepositorAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSOD1E133insTT-AcGFP1
Plasmid#83441PurposeExpresses SOD1E133insTT in mammalian cells.DepositorAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSOD1E133Δ-AcGFP1
Plasmid#83419PurposeExpresses SOD1E133Δ in mammalian cells.DepositorAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-10 in pcDNAI/Amp
Plasmid#55619PurposeAn amino-terminal CFP fragment was fused to Ggamma-10. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP-(1-158)-gamma-10 (GNG10 Human, Aequorea victoria)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-10 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-5 in pcDNAI/Amp
Plasmid#55191PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-5. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-5 (GNG5 Aequorea victoria, Bovine)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-5 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-11 in pcDNAI/Amp
Plasmid#55193PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-11. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-11 (GNG11 Aequorea victoria, Bovine)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-11 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-5 in pcDNAI/Amp
Plasmid#55617PurposeAn amino-terminal CFP fragment was fused to Ggamma-5. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP(1-158)-gamma-5 (GNG5 Aequorea victoria, Bovine)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-5 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-7 in pcDNAI/Amp
Plasmid#55618PurposeAn amino-terminal CFP fragment was fused to Ggamma-7. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP(1-158)-gamma-7 (GNG7 Human, Aequorea victoria)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-7 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-11 in pcDNAI/Amp
Plasmid#55620PurposeAn amino-terminal CFP fragment was fused to Ggamma-11. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP(1-158)-gamma-11 (GNG11 Aequorea victoria, Bovine)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-11 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-12 in pcDNAI/Amp
Plasmid#55621PurposeAn amino-terminal CFP fragment was fused to Ggamma-12. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP(1-158)-gamma-12 (GNG12 Human, Aequorea victoria)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-12 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-gamma-1 in pcDNAI/Amp
Plasmid#55623PurposeAn amino-terminal mCerulean fragment was fused to Ggamma-1. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCer(1-158)-gamma-1 (GNGT1 Aequorea victoria, Bovine)
TagsCer(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-1 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-gamma-2 in pcDNAI/Amp
Plasmid#55624PurposeAn amino-terminal mCerulean fragment was fused to Ggamma-2. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCer(1-158)-gamma-2 (Gng2 Mouse, Aequorea victoria)
TagsCer(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-2 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-gamma-7 in pcDNAI/Amp
Plasmid#55626PurposeAn amino-terminal mCerulean fragment was fused to Ggamma-7. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCer(1-158)-gamma-7 (GNG7 Human, Aequorea victoria)
TagsCer(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-7 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-gamma-10 in pcDNAI/Amp
Plasmid#55627PurposeAn N-terminal mCerulean fragment was fused to Ggamma-10. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCer(1-158)-gamma-10 (GNG10 Human, Aequorea victoria)
TagsCer(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-10 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-gamma-11 in pcDNAI/Amp
Plasmid#55628PurposeAn N-terminal mCerulean fragment was fused to Ggamma-11. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCer(1-158)-gamma-11 (GNG11 Aequorea victoria, Bovine)
TagsCer(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-11 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only