We narrowed to 6,905 results for: crispr cas9 plasmids
-
Plasmid#223158PurposeExpression of truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertMECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO Luc Firefly 2xgRNA - spCas9 iRFP670 puro
Plasmid#166134PurposeThis plasmid allows efficient KO of the firefly luciferase gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting firefly luciferase gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianMutationPromoterAvailable sinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
hCas9-VPR
Plasmid#68497Purposenuclease competent SP-Cas9 fused to VPRDepositorInsertSP-Cas9-VPR
UseTagsVPRExpressionMammalianMutationPromoterCMVAvailable sinceSept. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_gRNA1TERTKO_BsagRNA5tertko_2A-GFP
Plasmid#198863PurposePlasmid encoding for 2 gRNAs targeting the human TERT geneDepositorInsertTERT sgRNA (TERT Human)
UseTagsExpressionMammalianMutationPromoteru6Available sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
Plasmid#115694PurposeAll-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.DepositorInsertsNmeCas9
Nme-sgRNA
UseCRISPRTagsNLS and NLS, HAExpressionInsect and MammalianMutationNone and fusion of repeat/tracrRNA to make a sgRNAPromoterEF-1 alpha and U6Available sinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX335_U6-Chimeric_BB-CBh-hSpCas9n(D10A)_SOX17_Ex2_KI
Plasmid#195502PurposeCas9 nickase expression vector bearing a sgRNA targeting Exon 2 of human SOX17DepositorInsertsgRNA (SOX17 Human)
UseCRISPRTagsHAExpressionMammalianMutationPromoterU6Available sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only