We narrowed to 271 results for: lentiviral vectors expressing mcherry
-
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFIN-EF1a-CHER-WPRE
Plasmid#44353DepositorInsertEF1a-CHER
UseLentiviralPromoterhuman elongation factor -1a (pos 2526-3969)Available SinceMay 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
783-Rx-mU6: RfxCas13d gRNA and array cloning backbone
Plasmid#228361PurposemU6-driven expression of RfxCas13d gRNAs and arrays. Contains AarI sites for guide cloning.DepositorTypeEmpty backboneUseCRISPR and Lentiviral; Rfxcas13d grna expression …ExpressionMammalianPromotermU6Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgLenti-orthogonal
Plasmid#105997PurposeDual Streptococcus pyogenes and Staphylococcus aureus sgRNA expression vectorDepositorTypeEmpty backboneUseCRISPR and Lentiviral; S.pyogenes sgrna expressio…ExpressionMammalianPromoterU6Available SinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB1-1
Plasmid#121533PurposesgITGB1-1 sequence: GAAGCAGGGCCAAATTGTGGG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB1-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-3
Plasmid#121536PurposesgITGB4-3 sequence: GAGGAGCGTAGGTCCTCGCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-1
Plasmid#121535PurposesgITGB4-1 sequence: GAGGCGCAGTCCTTATCCACA. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB1-3
Plasmid#121534PurposesgITGB1-3 sequence: GTTCAGTGAATGGGAACAACG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB1-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
PGK_ACE2-ECD_Notch-Gal4VP64 (pZYW037)
Plasmid#194226PurposeLentiviral expression vector expressing ACE2-ECD SynNotch and mCherry transduction markerDepositorAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
783-Rx-hU6: RfxCas13d gRNA and array cloning backbone
Plasmid#228360PurposehU6-driven expression of RfxCas13d gRNAs and arrays compatible. Contains AarI sites for guide cloning flanked by 5' DR36DepositorTypeEmpty backboneUseCRISPR and Lentiviral; Rfxcas13d grna expression …ExpressionMammalianPromoterhU6Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
783-Rx-Dual: Combinatorial RfxCas13d gRNA and array cloning backbone
Plasmid#228362PurposemU6- and hU6-driven expression of dual RfxCas13d gRNAs and arrays for combinatorial RNA knockdown.DepositorTypeEmpty backboneUseCRISPR and Lentiviral; Rfxcas13d grna expression …ExpressionMammalianPromotermU6 and hU6Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti.PGK.chFP.W
Plasmid#51008PurposeLentivector that expresses chFP from internal human PGK promoterDepositorInsertmChFP
UseLentiviralExpressionMammalianPromoterhuman PGKAvailable SinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFIN-RK-GFP-mIRBP156-CHER-WPRE
Plasmid#44351DepositorInsertsRK-GFP
mIRBP156-CHER
UseLentiviralPromoterhuman rhodopsin kinase (pos 2554-2850) and mouse …Available SinceMay 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFIN-mIRBP156-CHER-RK-GFP-WPRE
Plasmid#44593DepositorInsertsIRBP156-CHER
RK-GFP
UseLentiviralPromoterhuman rhodopsin kinase (pos 3723-4019) and murine…Available SinceMay 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUltra-Hot-PC
Plasmid#184466PurposeLentiviral vector for bi-cistronic expression of mCherry and PC (seperated by P2A)DepositorAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSIN-TRE-SspB-mCh-p60
Plasmid#190170PurposeDoxycycline-inducible lentivirus vector to express SspBmicro-mCh-p60, a recruitable katanin for microtubule severing, in mammalian cells.DepositorInsertSspBmicro-mCherry-p60
UseLentiviralTagsSspBmicro-mCherryAvailable SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh-Puro
Plasmid#31845PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both mCherry and shRNA to be recombined out of the construct, turning OFF shRNA expression. Includes puromycin selection.DepositorTypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherry-puromycinAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh
Plasmid#31847PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both mCherry and shRNA to be recombined out of the construct, turning OFF shRNA expression.DepositorTypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherryAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
TFORF3550
Plasmid#145026PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens. This is the control vector for the collection.DepositorInsertmCherry
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-AncBE4max
Plasmid#174164PurposeThis is an AncBE4max (a cytosine base editor) expressing plasmid built on the 3rd generation system of lentiviral vector. It can be used for stable expression of AncBE4max in cells.DepositorInsertAncBE4max
UseLentiviralTagsP2A-mCherryAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only